Incidental Mutation 'R8359:Htr3b'
ID645922
Institutional Source Beutler Lab
Gene Symbol Htr3b
Ensembl Gene ENSMUSG00000008590
Gene Name5-hydroxytryptamine (serotonin) receptor 3B
Synonyms5-HT3B, 5-HT3 receptor subunit B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location48935008-48964990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 48947296 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 94 (S94R)
Ref Sequence ENSEMBL: ENSMUSP00000008734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008734]
Predicted Effect probably damaging
Transcript: ENSMUST00000008734
AA Change: S94R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000008734
Gene: ENSMUSG00000008590
AA Change: S94R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 28 235 1.5e-48 PFAM
Pfam:Neur_chan_memb 242 336 2.2e-15 PFAM
transmembrane domain 412 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit B of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It is not functional as a homomeric complex, but a pentaheteromeric complex with subunit A (HTR3A) displays the full functional features of this receptor. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Htr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Htr3b APN 9 48947634 missense probably damaging 1.00
IGL02576:Htr3b APN 9 48945504 missense possibly damaging 0.67
space UTSW 9 48937156 missense probably damaging 1.00
stove UTSW 9 48936043 splice site probably null
thermador UTSW 9 48959218 missense possibly damaging 0.94
R0594:Htr3b UTSW 9 48947631 missense probably benign 0.09
R1158:Htr3b UTSW 9 48936090 missense possibly damaging 0.55
R1690:Htr3b UTSW 9 48937094 missense possibly damaging 0.51
R2184:Htr3b UTSW 9 48947244 missense probably damaging 1.00
R3441:Htr3b UTSW 9 48945515 missense probably benign 0.01
R3442:Htr3b UTSW 9 48945515 missense probably benign 0.01
R4334:Htr3b UTSW 9 48945509 missense probably damaging 1.00
R4906:Htr3b UTSW 9 48937048 critical splice donor site probably null
R4985:Htr3b UTSW 9 48935941 missense possibly damaging 0.95
R4992:Htr3b UTSW 9 48959218 missense possibly damaging 0.94
R5197:Htr3b UTSW 9 48945515 missense probably benign 0.01
R5238:Htr3b UTSW 9 48937242 nonsense probably null
R6086:Htr3b UTSW 9 48947298 missense probably benign 0.16
R6328:Htr3b UTSW 9 48947633 missense probably damaging 1.00
R6412:Htr3b UTSW 9 48946519 missense possibly damaging 0.94
R7140:Htr3b UTSW 9 48937141 missense possibly damaging 0.52
R7349:Htr3b UTSW 9 48936019 missense probably benign 0.05
R7596:Htr3b UTSW 9 48936061 missense probably benign 0.31
R7815:Htr3b UTSW 9 48945533 missense probably benign 0.02
R7920:Htr3b UTSW 9 48937156 missense probably damaging 1.00
R7960:Htr3b UTSW 9 48945552 missense probably benign 0.08
R8103:Htr3b UTSW 9 48946549 missense possibly damaging 0.94
R8210:Htr3b UTSW 9 48936043 splice site probably null
R8318:Htr3b UTSW 9 48964877 start gained probably benign
R8507:Htr3b UTSW 9 48964877 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GATGTCAACTCCTGGCCATTTC -3'
(R):5'- AATCCATGCAAGGAGGTAGC -3'

Sequencing Primer
(F):5'- CCTTATAGTGATGACCCCAGTGATTG -3'
(R):5'- TCCATGCAAGGAGGTAGCCATAG -3'
Posted On2020-09-02