Incidental Mutation 'R8359:Synpo2l'
ID645931
Institutional Source Beutler Lab
Gene Symbol Synpo2l
Ensembl Gene ENSMUSG00000039376
Gene Namesynaptopodin 2-like
Synonyms1110054M18Rik, Chap
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location20658946-20668354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20666140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 126 (T126S)
Ref Sequence ENSEMBL: ENSMUSP00000112792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057090] [ENSMUST00000117386] [ENSMUST00000119483]
Predicted Effect probably benign
Transcript: ENSMUST00000057090
AA Change: T123S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053176
Gene: ENSMUSG00000039376
AA Change: T123S

DomainStartEndE-ValueType
PDZ 15 85 3.52e-10 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 151 162 N/A INTRINSIC
low complexity region 202 230 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 591 604 N/A INTRINSIC
low complexity region 700 726 N/A INTRINSIC
low complexity region 781 797 N/A INTRINSIC
low complexity region 867 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117386
AA Change: T126S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112792
Gene: ENSMUSG00000039376
AA Change: T126S

DomainStartEndE-ValueType
PDZ 15 88 1.34e-15 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
low complexity region 246 260 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
low complexity region 503 521 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 566 583 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 703 729 N/A INTRINSIC
low complexity region 784 800 N/A INTRINSIC
low complexity region 870 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119483
SMART Domains Protein: ENSMUSP00000112760
Gene: ENSMUSG00000039376

DomainStartEndE-ValueType
low complexity region 203 218 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 474 500 N/A INTRINSIC
low complexity region 555 571 N/A INTRINSIC
low complexity region 641 654 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Synpo2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0048:Synpo2l UTSW 14 20666272 unclassified probably benign
R0277:Synpo2l UTSW 14 20661788 missense probably damaging 1.00
R0440:Synpo2l UTSW 14 20661398 missense possibly damaging 0.89
R0540:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0607:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0712:Synpo2l UTSW 14 20661839 missense probably damaging 1.00
R1175:Synpo2l UTSW 14 20668167 missense possibly damaging 0.93
R1563:Synpo2l UTSW 14 20661278 missense probably damaging 1.00
R1729:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1730:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1739:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R2199:Synpo2l UTSW 14 20661919 missense probably benign 0.00
R2213:Synpo2l UTSW 14 20660666 missense probably damaging 1.00
R3085:Synpo2l UTSW 14 20662180 missense probably damaging 1.00
R4787:Synpo2l UTSW 14 20661697 missense possibly damaging 0.49
R5256:Synpo2l UTSW 14 20661014 missense probably benign 0.00
R5454:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5455:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5765:Synpo2l UTSW 14 20666130 missense possibly damaging 0.95
R5950:Synpo2l UTSW 14 20665935 missense probably benign 0.00
R6376:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R6438:Synpo2l UTSW 14 20661136 missense probably benign 0.00
R6440:Synpo2l UTSW 14 20668176 missense probably damaging 0.98
R6511:Synpo2l UTSW 14 20662450 missense probably damaging 1.00
R6834:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R7735:Synpo2l UTSW 14 20661175 missense possibly damaging 0.88
R7968:Synpo2l UTSW 14 20666802 splice site probably null
R8250:Synpo2l UTSW 14 20662276 missense probably benign 0.03
R8282:Synpo2l UTSW 14 20661136 missense probably benign 0.00
Z1088:Synpo2l UTSW 14 20665967 missense probably damaging 0.99
Z1177:Synpo2l UTSW 14 20660504 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAGATGGGGAGCTTACAC -3'
(R):5'- CCCTCCAGAGCTGTTAGTTC -3'

Sequencing Primer
(F):5'- GAGCCAGTTTTAACAGGTGC -3'
(R):5'- AGCTGTTAGTTCTGTGGCTCCC -3'
Posted On2020-09-02