Incidental Mutation 'R8359:Myh11'
ID645934
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Namemyosin, heavy polypeptide 11, smooth muscle
SynonymssmMHC, SM1, SM2
Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location14194535-14291372 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 14208231 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
Predicted Effect probably null
Transcript: ENSMUST00000090287
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000230397
Predicted Effect probably null
Transcript: ENSMUST00000231567
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14277722 missense probably benign 0.00
IGL01398:Myh11 APN 16 14202100 missense probably damaging 0.99
IGL01646:Myh11 APN 16 14221775 missense probably damaging 1.00
IGL02470:Myh11 APN 16 14218046 missense probably damaging 1.00
IGL02680:Myh11 APN 16 14209520 missense probably benign 0.02
IGL02687:Myh11 APN 16 14212618 nonsense probably null
IGL02987:Myh11 APN 16 14232532 missense probably damaging 1.00
IGL03008:Myh11 APN 16 14204753 missense probably benign 0.00
G5030:Myh11 UTSW 16 14250579 missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14201066 missense
R0008:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0085:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0086:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0087:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14211260 missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14218880 missense probably benign 0.32
R0546:Myh11 UTSW 16 14205628 missense probably damaging 1.00
R0658:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0715:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14203178 missense probably damaging 1.00
R1014:Myh11 UTSW 16 14236410 missense possibly damaging 0.70
R1104:Myh11 UTSW 16 14202127 missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14205931 nonsense probably null
R1560:Myh11 UTSW 16 14226620 nonsense probably null
R1714:Myh11 UTSW 16 14236368 critical splice donor site probably null
R1742:Myh11 UTSW 16 14220044 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14200758 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14215790 missense probably damaging 0.98
R1753:Myh11 UTSW 16 14277870 missense probably benign
R1760:Myh11 UTSW 16 14233695 splice site probably benign
R1829:Myh11 UTSW 16 14223880 missense probably damaging 1.00
R1876:Myh11 UTSW 16 14269103 splice site probably benign
R2027:Myh11 UTSW 16 14232668 missense probably damaging 1.00
R2122:Myh11 UTSW 16 14218004 missense probably damaging 1.00
R2247:Myh11 UTSW 16 14277559 missense probably damaging 1.00
R2495:Myh11 UTSW 16 14205557 missense probably damaging 1.00
R2863:Myh11 UTSW 16 14239426 missense probably benign 0.02
R3684:Myh11 UTSW 16 14203234 missense probably benign 0.00
R3693:Myh11 UTSW 16 14217949 missense probably benign 0.01
R4080:Myh11 UTSW 16 14224059 missense possibly damaging 0.83
R4367:Myh11 UTSW 16 14218883 missense probably damaging 0.97
R4664:Myh11 UTSW 16 14226584 missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14269241 missense probably damaging 0.99
R4694:Myh11 UTSW 16 14200702 missense probably damaging 1.00
R4805:Myh11 UTSW 16 14234465 missense possibly damaging 0.61
R4806:Myh11 UTSW 16 14201083 splice site probably null
R4905:Myh11 UTSW 16 14250523 missense probably benign 0.13
R4939:Myh11 UTSW 16 14239507 missense probably benign
R4964:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R4966:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R5029:Myh11 UTSW 16 14205625 missense probably damaging 1.00
R5045:Myh11 UTSW 16 14239527 nonsense probably null
R5097:Myh11 UTSW 16 14205906 splice site probably null
R5288:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14244855 missense probably damaging 0.96
R5856:Myh11 UTSW 16 14205976 missense probably benign 0.00
R5869:Myh11 UTSW 16 14230800 missense probably damaging 1.00
R6019:Myh11 UTSW 16 14206074 missense probably damaging 1.00
R6024:Myh11 UTSW 16 14277703 missense probably damaging 0.99
R6139:Myh11 UTSW 16 14215874 missense probably damaging 1.00
R6209:Myh11 UTSW 16 14208291 nonsense probably null
R6373:Myh11 UTSW 16 14205130 missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14205553 missense probably damaging 1.00
R6709:Myh11 UTSW 16 14223494 critical splice donor site probably null
R7069:Myh11 UTSW 16 14218939 missense possibly damaging 0.95
R7176:Myh11 UTSW 16 14215826 missense
R7644:Myh11 UTSW 16 14221824 missense
R7838:Myh11 UTSW 16 14209617 missense
R7905:Myh11 UTSW 16 14207681 nonsense probably null
R8261:Myh11 UTSW 16 14224003 missense
R8272:Myh11 UTSW 16 14218854 missense
R8317:Myh11 UTSW 16 14208077 missense
X0018:Myh11 UTSW 16 14277633 missense probably damaging 1.00
X0025:Myh11 UTSW 16 14209689 missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14234402 missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14269262 frame shift probably null
Z1176:Myh11 UTSW 16 14239396 missense probably null
Z1176:Myh11 UTSW 16 14277775 missense
Z1177:Myh11 UTSW 16 14209595 missense
Predicted Primers PCR Primer
(F):5'- GCGCTCCAGGTTTTGCTTAG -3'
(R):5'- TGAAAAGGGCTCCTCTTGC -3'

Sequencing Primer
(F):5'- TCATCCAGCTGGTCCTGCAG -3'
(R):5'- CCTCTTGCCGATCTGTGATTTGAG -3'
Posted On2020-09-02