Incidental Mutation 'R8359:Hspbap1'
ID645935
Institutional Source Beutler Lab
Gene Symbol Hspbap1
Ensembl Gene ENSMUSG00000022849
Gene NameHspb associated protein 1
Synonyms3830421G21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35770375-35828477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35824996 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 350 (N350K)
Ref Sequence ENSEMBL: ENSMUSP00000156217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023555] [ENSMUST00000231579]
Predicted Effect probably benign
Transcript: ENSMUST00000023555
SMART Domains Protein: ENSMUSP00000023555
Gene: ENSMUSG00000022849

DomainStartEndE-ValueType
JmjC 126 288 1.29e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231579
AA Change: N350K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to one of the small heat shock proteins, specifically hsp27. Hsp27 is involved with cell growth and differentiation. This encoded protein was found to be abnormally expressed in patients with intractable epilepsy, although how brain function is affected remains unknown. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Hspbap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hspbap1 APN 16 35814061 splice site probably benign
IGL01377:Hspbap1 APN 16 35825311 missense possibly damaging 0.48
IGL03070:Hspbap1 APN 16 35818726 missense probably damaging 0.96
R1099:Hspbap1 UTSW 16 35824944 missense probably damaging 0.99
R1346:Hspbap1 UTSW 16 35801665 missense probably damaging 1.00
R1532:Hspbap1 UTSW 16 35825303 missense probably damaging 1.00
R1848:Hspbap1 UTSW 16 35818764 critical splice donor site probably null
R1867:Hspbap1 UTSW 16 35801564 missense possibly damaging 0.77
R4512:Hspbap1 UTSW 16 35787241 missense probably damaging 0.98
R4718:Hspbap1 UTSW 16 35787322 missense probably benign 0.07
R5553:Hspbap1 UTSW 16 35801597 missense probably damaging 1.00
R5590:Hspbap1 UTSW 16 35801663 missense probably damaging 1.00
R6151:Hspbap1 UTSW 16 35817222 missense probably damaging 1.00
R6612:Hspbap1 UTSW 16 35801591 missense probably damaging 1.00
R7253:Hspbap1 UTSW 16 35817230 missense unknown
R7314:Hspbap1 UTSW 16 35825171 missense probably benign 0.00
R8256:Hspbap1 UTSW 16 35770509 missense probably benign 0.01
R8304:Hspbap1 UTSW 16 35787325 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGAAGACTGCAGAGGAC -3'
(R):5'- TGCTGACAGATTCTTCGCTG -3'

Sequencing Primer
(F):5'- TGAACCCCACTGAGGTAGGAC -3'
(R):5'- TGTCGCCTTCCAGTGCG -3'
Posted On2020-09-02