Incidental Mutation 'R8359:Cyp21a1'
ID645939
Institutional Source Beutler Lab
Gene Symbol Cyp21a1
Ensembl Gene ENSMUSG00000024365
Gene Namecytochrome P450, family 21, subfamily a, polypeptide 1
SynonymsOh21-1, 21OHA, 21-hydroxylase, 21-OH, Cyp21, 21OH, Oh21-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34801348-34804561 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 34802131 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025223]
Predicted Effect probably null
Transcript: ENSMUST00000025223
SMART Domains Protein: ENSMUSP00000025223
Gene: ENSMUSG00000024365

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:p450 29 473 3.9e-98 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and hydroxylates steroids at the 21 position. Its activity is required for the synthesis of steroid hormones including cortisol and aldosterone. Mutations in this gene cause congenital adrenal hyperplasia. A related pseudogene is located near this gene; gene conversion events involving the functional gene and the pseudogene are thought to account for many cases of steroid 21-hydroxylase deficiency. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: An 80kb deletion including Cyp21a1 is found in mice with the H2 haplotype aw18. Homozygotes are lethal, but can be rescued with a Cyp21a1 transgene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Cyp21a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cyp21a1 APN 17 34804134 critical splice acceptor site probably null
IGL01688:Cyp21a1 APN 17 34802220 missense probably damaging 1.00
IGL02352:Cyp21a1 APN 17 34804222 missense probably damaging 1.00
IGL02359:Cyp21a1 APN 17 34804222 missense probably damaging 1.00
IGL02418:Cyp21a1 APN 17 34804188 splice site probably benign
IGL03089:Cyp21a1 APN 17 34803446 splice site probably null
R0480:Cyp21a1 UTSW 17 34801826 missense probably damaging 1.00
R1386:Cyp21a1 UTSW 17 34802210 missense probably damaging 0.98
R1831:Cyp21a1 UTSW 17 34804035 splice site probably benign
R2159:Cyp21a1 UTSW 17 34802404 missense probably benign 0.21
R2209:Cyp21a1 UTSW 17 34802727 nonsense probably null
R4968:Cyp21a1 UTSW 17 34803409 missense possibly damaging 0.93
R5957:Cyp21a1 UTSW 17 34803176 missense probably benign 0.13
R6374:Cyp21a1 UTSW 17 34804136 splice site probably null
R7077:Cyp21a1 UTSW 17 34802359 missense probably damaging 1.00
R7143:Cyp21a1 UTSW 17 34802326 missense probably damaging 1.00
R7798:Cyp21a1 UTSW 17 34804321 missense probably benign 0.30
R8192:Cyp21a1 UTSW 17 34803659 missense probably damaging 1.00
R8460:Cyp21a1 UTSW 17 34802870 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCGTCCTATCCTGTCAAGG -3'
(R):5'- AACTAGGGCTAGCAGGTGATTC -3'

Sequencing Primer
(F):5'- TCGGGAGATTGATGCCAGC -3'
(R):5'- GCTAGCAGGTGATTCCCTGG -3'
Posted On2020-09-02