Mutagenetix > Incidental Mutation

Incidental Mutation 'R8359:Adgrf1'

645940

Institutional Source

Beutler Lab

Gene Symbol

Adgrf1

Ensembl Gene

ENSMUSG00000041293

Gene Name

adhesion G protein-coupled receptor F1

Synonyms

Gpr110, 5031409J19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8359 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43270329-43324737 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43310395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 508 (I508F)

Ref Sequence

ENSEMBL: ENSMUSP00000049380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047399]

AlphaFold

Q8VEC3

Predicted Effect

probably damaging
Transcript: ENSMUST00000047399
AA Change: I508F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049380
Gene: ENSMUSG00000041293
AA Change: I508F

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	59	83	N/A	INTRINSIC
Pfam:SEA	150	238	3.7e-10	PFAM
low complexity region	341	363	N/A	INTRINSIC
GPS	528	576	5.56e-15	SMART
Pfam:7tm_2	580	832	2.1e-38	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam5	A	T	8: 24,806,486	V315D	probably damaging	Het
Atpaf2	T	C	11: 60,407,303	D147G	probably damaging	Het
Brwd1	T	C	16: 96,016,209	T1368A	probably damaging	Het
Cacna1s	A	T	1: 136,116,061	E1626V	probably benign	Het
Carm1	G	A	9: 21,569,469	V80I	possibly damaging	Het
Casc4	A	T	2: 121,867,151		probably benign	Het
Cenpw	T	A	10: 30,198,488	D71V	probably damaging	Het
Cit	T	A	5: 115,984,544		probably null	Het
Ckmt1	A	T	2: 121,363,050	T364S	probably benign	Het
Col6a4	T	C	9: 106,068,384	S844G	probably benign	Het
Crybg1	T	C	10: 43,992,542	E1380G	probably benign	Het
Cyp21a1	A	G	17: 34,802,131		probably null	Het
D430042O09Rik	T	C	7: 125,868,851		probably null	Het
Dhodh	A	C	8: 109,606,406	D12E	probably benign	Het
Dnali1	T	A	4: 125,063,667	T95S	probably damaging	Het
Dynlrb1	A	G	2: 155,249,950	N93D	probably benign	Het
Edem1	C	T	6: 108,846,813	A390V	probably benign	Het
Enthd1	T	C	15: 80,474,155	D388G	probably benign	Het
Fam170a	A	G	18: 50,281,610	T108A	probably damaging	Het
Fryl	A	G	5: 73,075,933	S1531P	probably benign	Het
Hspbap1	C	A	16: 35,824,996	N350K	probably benign	Het
Htr3b	A	C	9: 48,947,296	S94R	probably damaging	Het
Ide	A	T	19: 37,330,487	V42E		Het
Igf2r	A	G	17: 12,683,861	V2434A	probably benign	Het
Kif16b	G	A	2: 142,711,857	A1007V	probably benign	Het
Mccc1	C	T	3: 35,964,344	V614I	probably benign	Het
Mos	A	G	4: 3,871,097	Y240H	probably damaging	Het
Myh11	C	T	16: 14,208,231		probably null	Het
Nexn	T	A	3: 152,248,361	D166V	probably damaging	Het
Olfr1192-ps1	A	T	2: 88,652,988	M279L	probably benign	Het
Olfr328	G	T	11: 58,552,203	T12N	probably benign	Het
Olfr510	T	A	7: 108,668,311	N298K	probably benign	Het
Olfr55	G	A	17: 33,176,921	C173Y	probably damaging	Het
Pkp4	A	G	2: 59,350,551	Y1061C	probably damaging	Het
Pla2g6	T	C	15: 79,287,170	D740G	probably damaging	Het
Pla2r1	T	A	2: 60,443,283	I920L	probably benign	Het
Plekha2	A	G	8: 25,088,391	I31T	probably damaging	Het
Ppp1r16b	G	T	2: 158,761,375	V407L	probably benign	Het
Prss50	A	G	9: 110,862,302	I225V	probably damaging	Het
Rmdn2	A	T	17: 79,628,151	E231V		Het
Sema3c	T	C	5: 17,653,728	S42P	possibly damaging	Het
Sh2d1b1	T	A	1: 170,283,124		probably null	Het
Slc22a20	T	C	19: 5,971,526	I483V	probably benign	Het
Slc30a2	T	C	4: 134,349,379	V275A	probably damaging	Het
Slc6a3	T	A	13: 73,544,883	F207L	probably benign	Het
Slc9a1	A	T	4: 133,420,616	Q648H	probably damaging	Het
Slpi	A	T	2: 164,356,055	M1K	probably null	Het
Smc5	A	C	19: 23,234,079	S564A	possibly damaging	Het
Smchd1	A	T	17: 71,431,243	F542L	probably damaging	Het
Sycp1	T	A	3: 102,820,593	K901N	probably damaging	Het
Synpo2l	T	A	14: 20,666,140	T126S	probably benign	Het
Upp2	A	G	2: 58,777,943	N216S	probably benign	Het
Wnk1	T	C	6: 119,992,447	D349G	probably damaging	Het
Zfp180	C	T	7: 24,104,912	A252V	probably benign	Het
Zfr2	C	T	10: 81,242,819	T295I	possibly damaging	Het
Zkscan16	C	T	4: 58,957,230	T504I	possibly damaging	Het

Other mutations in Adgrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Adgrf1	APN	17	43313195	missense	probably null	0.92
IGL01359:Adgrf1	APN	17	43310686	missense	probably damaging	0.99
IGL02131:Adgrf1	APN	17	43303747	missense	probably damaging	0.99
IGL02692:Adgrf1	APN	17	43303778	missense	probably damaging	1.00
IGL02891:Adgrf1	APN	17	43311161	missense	probably damaging	0.96
IGL03027:Adgrf1	APN	17	43296714	missense	probably damaging	1.00
IGL03296:Adgrf1	APN	17	43321153	splice site	probably benign
R0211:Adgrf1	UTSW	17	43296690	missense	probably damaging	1.00
R0211:Adgrf1	UTSW	17	43296690	missense	probably damaging	1.00
R0389:Adgrf1	UTSW	17	43303788	critical splice donor site	probably null
R0488:Adgrf1	UTSW	17	43310411	missense	probably damaging	0.99
R1591:Adgrf1	UTSW	17	43310981	missense	probably damaging	1.00
R1817:Adgrf1	UTSW	17	43310033	missense	probably benign	0.01
R1819:Adgrf1	UTSW	17	43310033	missense	probably benign	0.01
R2009:Adgrf1	UTSW	17	43321221	nonsense	probably null
R2032:Adgrf1	UTSW	17	43311275	missense	probably damaging	1.00
R2140:Adgrf1	UTSW	17	43300802	missense	probably damaging	0.99
R3953:Adgrf1	UTSW	17	43310207	missense	probably benign	0.08
R4679:Adgrf1	UTSW	17	43310493	missense	probably damaging	1.00
R4775:Adgrf1	UTSW	17	43311163	missense	probably damaging	1.00
R4858:Adgrf1	UTSW	17	43303672	missense	probably damaging	1.00
R4894:Adgrf1	UTSW	17	43299084	nonsense	probably null
R4895:Adgrf1	UTSW	17	43310620	missense	probably benign	0.33
R4935:Adgrf1	UTSW	17	43295239	missense	probably benign	0.00
R5027:Adgrf1	UTSW	17	43303747	missense	probably damaging	0.99
R5373:Adgrf1	UTSW	17	43291005	start gained	probably benign
R5374:Adgrf1	UTSW	17	43291005	start gained	probably benign
R5455:Adgrf1	UTSW	17	43321143	splice site	probably null
R5579:Adgrf1	UTSW	17	43311064	missense	probably damaging	1.00
R5985:Adgrf1	UTSW	17	43293255	missense	probably benign	0.00
R6038:Adgrf1	UTSW	17	43295209	missense	probably benign	0.00
R6038:Adgrf1	UTSW	17	43295209	missense	probably benign	0.00
R6160:Adgrf1	UTSW	17	43310687	missense	probably damaging	1.00
R6227:Adgrf1	UTSW	17	43310273	missense	probably benign	0.05
R6500:Adgrf1	UTSW	17	43310372	missense	probably damaging	1.00
R7066:Adgrf1	UTSW	17	43310260	missense	probably benign	0.05
R7099:Adgrf1	UTSW	17	43310602	missense	probably benign	0.00
R7561:Adgrf1	UTSW	17	43311109	missense	possibly damaging	0.94
R8480:Adgrf1	UTSW	17	43295164	missense	probably benign	0.08
R8543:Adgrf1	UTSW	17	43313206	missense	probably null	0.99
R9023:Adgrf1	UTSW	17	43303760	missense	possibly damaging	0.53
R9074:Adgrf1	UTSW	17	43290988	start gained	probably benign
R9207:Adgrf1	UTSW	17	43310273	missense	probably benign	0.05
R9232:Adgrf1	UTSW	17	43310404	missense	probably benign	0.07
R9425:Adgrf1	UTSW	17	43310383	missense	possibly damaging	0.84
R9526:Adgrf1	UTSW	17	43305346	missense	possibly damaging	0.95
R9697:Adgrf1	UTSW	17	43314471	missense	possibly damaging	0.71
R9711:Adgrf1	UTSW	17	43310689	missense	possibly damaging	0.81
Z1177:Adgrf1	UTSW	17	43310147	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TCATTGACTGGAAAGGGACCC -3'
(R):5'- GTGACTACATCGGCACAGTAC -3'

Sequencing Primer
(F):5'- CACGGGGCTACAACTATCAGATG -3'
(R):5'- ACAGTACCGTGTCCAGAGTTTC -3'

Posted On

2020-09-02