Incidental Mutation 'R8359:Adgrf1'
ID645940
Institutional Source Beutler Lab
Gene Symbol Adgrf1
Ensembl Gene ENSMUSG00000041293
Gene Nameadhesion G protein-coupled receptor F1
SynonymsGpr110, 5031409J19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location43270329-43324737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43310395 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 508 (I508F)
Ref Sequence ENSEMBL: ENSMUSP00000049380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047399]
Predicted Effect probably damaging
Transcript: ENSMUST00000047399
AA Change: I508F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049380
Gene: ENSMUSG00000041293
AA Change: I508F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 59 83 N/A INTRINSIC
Pfam:SEA 150 238 3.7e-10 PFAM
low complexity region 341 363 N/A INTRINSIC
GPS 528 576 5.56e-15 SMART
Pfam:7tm_2 580 832 2.1e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Adgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Adgrf1 APN 17 43313195 missense probably null 0.92
IGL01359:Adgrf1 APN 17 43310686 missense probably damaging 0.99
IGL02131:Adgrf1 APN 17 43303747 missense probably damaging 0.99
IGL02692:Adgrf1 APN 17 43303778 missense probably damaging 1.00
IGL02891:Adgrf1 APN 17 43311161 missense probably damaging 0.96
IGL03027:Adgrf1 APN 17 43296714 missense probably damaging 1.00
IGL03296:Adgrf1 APN 17 43321153 splice site probably benign
R0211:Adgrf1 UTSW 17 43296690 missense probably damaging 1.00
R0211:Adgrf1 UTSW 17 43296690 missense probably damaging 1.00
R0389:Adgrf1 UTSW 17 43303788 critical splice donor site probably null
R0488:Adgrf1 UTSW 17 43310411 missense probably damaging 0.99
R1591:Adgrf1 UTSW 17 43310981 missense probably damaging 1.00
R1817:Adgrf1 UTSW 17 43310033 missense probably benign 0.01
R1819:Adgrf1 UTSW 17 43310033 missense probably benign 0.01
R2009:Adgrf1 UTSW 17 43321221 nonsense probably null
R2032:Adgrf1 UTSW 17 43311275 missense probably damaging 1.00
R2140:Adgrf1 UTSW 17 43300802 missense probably damaging 0.99
R3953:Adgrf1 UTSW 17 43310207 missense probably benign 0.08
R4679:Adgrf1 UTSW 17 43310493 missense probably damaging 1.00
R4775:Adgrf1 UTSW 17 43311163 missense probably damaging 1.00
R4858:Adgrf1 UTSW 17 43303672 missense probably damaging 1.00
R4894:Adgrf1 UTSW 17 43299084 nonsense probably null
R4895:Adgrf1 UTSW 17 43310620 missense probably benign 0.33
R4935:Adgrf1 UTSW 17 43295239 missense probably benign 0.00
R5027:Adgrf1 UTSW 17 43303747 missense probably damaging 0.99
R5373:Adgrf1 UTSW 17 43291005 start gained probably benign
R5374:Adgrf1 UTSW 17 43291005 start gained probably benign
R5455:Adgrf1 UTSW 17 43321143 splice site probably null
R5579:Adgrf1 UTSW 17 43311064 missense probably damaging 1.00
R5985:Adgrf1 UTSW 17 43293255 missense probably benign 0.00
R6038:Adgrf1 UTSW 17 43295209 missense probably benign 0.00
R6038:Adgrf1 UTSW 17 43295209 missense probably benign 0.00
R6160:Adgrf1 UTSW 17 43310687 missense probably damaging 1.00
R6227:Adgrf1 UTSW 17 43310273 missense probably benign 0.05
R6500:Adgrf1 UTSW 17 43310372 missense probably damaging 1.00
R7066:Adgrf1 UTSW 17 43310260 missense probably benign 0.05
R7099:Adgrf1 UTSW 17 43310602 missense probably benign 0.00
R7561:Adgrf1 UTSW 17 43311109 missense possibly damaging 0.94
Z1177:Adgrf1 UTSW 17 43310147 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCATTGACTGGAAAGGGACCC -3'
(R):5'- GTGACTACATCGGCACAGTAC -3'

Sequencing Primer
(F):5'- CACGGGGCTACAACTATCAGATG -3'
(R):5'- ACAGTACCGTGTCCAGAGTTTC -3'
Posted On2020-09-02