Incidental Mutation 'R8359:Ide'
ID645946
Institutional Source Beutler Lab
Gene Symbol Ide
Ensembl Gene ENSMUSG00000056999
Gene Nameinsulin degrading enzyme
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location37268743-37337852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37330487 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 42 (V42E)
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000121358
Gene: ENSMUSG00000056999
AA Change: V42E

DomainStartEndE-ValueType
Pfam:Peptidase_M16 42 180 8.1e-49 PFAM
Pfam:Peptidase_M16_C 205 385 2.1e-25 PFAM
Pfam:Peptidase_M16_M 389 671 1.9e-106 PFAM
Pfam:Peptidase_M16_C 674 857 9.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption of this gene display beta amyloid accumulations in the brain, hyperinsulinemia and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Ide
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ide APN 19 37276532 missense unknown
IGL01924:Ide APN 19 37272164 missense unknown
IGL01925:Ide APN 19 37277897 missense unknown
IGL02616:Ide APN 19 37298056 missense unknown
R0738:Ide UTSW 19 37277965 nonsense probably null
R1509:Ide UTSW 19 37285204 critical splice donor site probably null
R1557:Ide UTSW 19 37280761 splice site probably null
R2935:Ide UTSW 19 37325307 missense unknown
R4260:Ide UTSW 19 37329186 missense unknown
R4261:Ide UTSW 19 37329186 missense unknown
R4575:Ide UTSW 19 37272205 missense unknown
R4913:Ide UTSW 19 37329070 missense unknown
R4933:Ide UTSW 19 37277756 missense unknown
R4951:Ide UTSW 19 37285232 missense unknown
R5102:Ide UTSW 19 37314984 missense unknown
R5474:Ide UTSW 19 37272184 missense unknown
R5502:Ide UTSW 19 37330456 missense unknown
R5546:Ide UTSW 19 37272224 missense unknown
R5601:Ide UTSW 19 37314980 missense unknown
R5696:Ide UTSW 19 37318021 missense unknown
R5884:Ide UTSW 19 37272153 critical splice donor site probably null
R5983:Ide UTSW 19 37272150 splice site probably null
R6286:Ide UTSW 19 37278010 missense unknown
R7146:Ide UTSW 19 37295944 missense
R7224:Ide UTSW 19 37290761 missense
R7234:Ide UTSW 19 37290785 missense
R7695:Ide UTSW 19 37329036 missense
R7771:Ide UTSW 19 37298126 missense
R7811:Ide UTSW 19 37330511 missense
R7893:Ide UTSW 19 37284151 missense
R8289:Ide UTSW 19 37313553 missense
R8289:Ide UTSW 19 37313554 missense probably null
R8421:Ide UTSW 19 37278004 missense
Z1176:Ide UTSW 19 37315491 missense
Predicted Primers PCR Primer
(F):5'- AAACTGTGATAACTACCGGGTTC -3'
(R):5'- TAAGTTGCAGCCAGGTAGGTG -3'

Sequencing Primer
(F):5'- AACTACCGGGTTCTTATGCTCACAG -3'
(R):5'- GCCTGTTCTGGAACTCTAGACTAG -3'
Posted On2020-09-02