Incidental Mutation 'R0034:Map2k4'
ID64595
Institutional Source Beutler Lab
Gene Symbol Map2k4
Ensembl Gene ENSMUSG00000033352
Gene Namemitogen-activated protein kinase kinase 4
SynonymsSerk1, MKK4, Sek1, JNKK1
MMRRC Submission 038328-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0034 (G1)
Quality Score138
Status Validated
Chromosome11
Chromosomal Location65688243-65788297 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 65719611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046963] [ENSMUST00000125598] [ENSMUST00000130009] [ENSMUST00000138093] [ENSMUST00000140301] [ENSMUST00000152096]
Predicted Effect probably benign
Transcript: ENSMUST00000046963
SMART Domains Protein: ENSMUSP00000041282
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
S_TKc 100 365 9.38e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125598
SMART Domains Protein: ENSMUSP00000137656
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
Pfam:Pkinase 34 128 8.4e-27 PFAM
Pfam:Kinase-like 36 128 8.9e-8 PFAM
Pfam:Pkinase_Tyr 37 129 6.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130009
SMART Domains Protein: ENSMUSP00000137819
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138093
Predicted Effect probably benign
Transcript: ENSMUST00000140301
SMART Domains Protein: ENSMUSP00000137955
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152096
SMART Domains Protein: ENSMUSP00000114219
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 111 202 2.5e-9 PFAM
Pfam:Pkinase 111 204 1e-13 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase (MAPK) family. Members of this family act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation, and development. They form a three-tiered signaling module composed of MAPKKKs, MAPKKs, and MAPKs. This protein is phosphorylated at serine and threonine residues by MAPKKKs and subsequently phosphorylates downstream MAPK targets at threonine and tyrosine residues. A similar protein in mouse has been reported to play a role in liver organogenesis. A pseudogene of this gene is located on the long arm of chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal liver development with a deficiency of parenchymal hepatocytes, severe anemia, and lethality before embryonic day 14.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C A 19: 7,420,359 H90Q probably damaging Het
4930402H24Rik T C 2: 130,736,572 H664R probably damaging Het
9430038I01Rik C T 7: 137,387,592 R60Q probably benign Het
Angpt4 C T 2: 151,929,391 T209I probably benign Het
Ap3b1 T C 13: 94,479,885 probably benign Het
Aplp1 A C 7: 30,444,442 V56G probably damaging Het
Asns G A 6: 7,676,299 P419L probably damaging Het
Atxn7 A T 14: 14,100,846 H844L probably damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cd300lb C T 11: 114,928,399 V135I probably damaging Het
Cep152 C T 2: 125,583,893 A851T probably benign Het
Cfap74 C T 4: 155,460,887 probably benign Het
Col28a1 T A 6: 8,175,708 I47L probably benign Het
Eef1d T C 15: 75,902,959 T200A probably benign Het
Faap100 A T 11: 120,372,147 M795K probably benign Het
Gabpb1 C T 2: 126,658,534 R15Q possibly damaging Het
Gata4 C A 14: 63,201,484 M381I probably benign Het
Gm5114 A G 7: 39,408,858 S446P possibly damaging Het
Gm7271 A G 5: 76,516,530 I155M probably damaging Het
Gnb1 T A 4: 155,551,689 N155K probably benign Het
Haspin G A 11: 73,138,218 T15M probably damaging Het
Heatr5a A G 12: 51,925,172 L745P probably damaging Het
Kcng3 T A 17: 83,588,383 probably benign Het
Kif15 A T 9: 122,999,285 N887I possibly damaging Het
Kif26a T C 12: 112,168,963 probably benign Het
Kif9 G A 9: 110,519,611 C738Y probably benign Het
Kifc2 G T 15: 76,667,100 C613F probably benign Het
Klf12 A G 14: 99,987,429 probably null Het
Lrp1 A T 10: 127,545,651 I3826N probably benign Het
Myo7b A G 18: 31,960,860 S2006P probably damaging Het
Olfr631 T C 7: 103,929,501 V226A probably benign Het
Pax4 T C 6: 28,442,449 T285A probably benign Het
Pcdhb5 A G 18: 37,322,084 N506D probably damaging Het
Pkhd1l1 G A 15: 44,504,009 G768S probably benign Het
Plb1 G T 5: 32,273,113 G138V probably benign Het
Poln A C 5: 34,115,418 V398G possibly damaging Het
Poteg A G 8: 27,462,077 probably benign Het
Rapgef1 C A 2: 29,724,768 probably benign Het
Rbm43 A T 2: 51,925,710 D166E probably benign Het
Rhobtb2 T C 14: 69,788,688 T602A probably benign Het
Samd3 G A 10: 26,271,500 probably benign Het
Sbno2 A C 10: 80,058,340 probably benign Het
Sec1 A G 7: 45,679,335 V96A probably benign Het
Senp7 A C 16: 56,153,570 S385R possibly damaging Het
Sgk3 T C 1: 9,885,677 V301A probably damaging Het
Sgpl1 A T 10: 61,102,613 M467K probably damaging Het
Slc22a26 A G 19: 7,802,253 I66T probably benign Het
Stra6 G A 9: 58,151,469 probably null Het
Tfrc T A 16: 32,615,396 probably null Het
Tmem30b T C 12: 73,546,005 Y112C probably damaging Het
Trap1 A T 16: 4,069,030 probably benign Het
Trpc1 A G 9: 95,749,761 S43P probably damaging Het
Tsku T C 7: 98,352,663 T154A possibly damaging Het
Uroc1 T C 6: 90,345,310 V272A probably damaging Het
Vmn1r69 T A 7: 10,580,811 probably benign Het
Vmn2r1 T A 3: 64,090,014 W364R probably damaging Het
Wnk2 G T 13: 49,068,080 T377K possibly damaging Het
Zscan20 T C 4: 128,585,662 N1012S probably damaging Het
Other mutations in Map2k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Map2k4 APN 11 65719479 splice site probably benign
IGL01318:Map2k4 APN 11 65756263 splice site probably benign
IGL02500:Map2k4 APN 11 65696310 missense probably damaging 1.00
IGL02628:Map2k4 APN 11 65690741 missense possibly damaging 0.83
IGL02873:Map2k4 APN 11 65719574 missense probably damaging 0.97
IGL03124:Map2k4 APN 11 65690791 missense probably damaging 0.98
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0646:Map2k4 UTSW 11 65712275 missense probably damaging 1.00
R2073:Map2k4 UTSW 11 65693456 missense probably damaging 0.99
R2931:Map2k4 UTSW 11 65756337 missense probably damaging 0.99
R3800:Map2k4 UTSW 11 65690781 nonsense probably null
R4820:Map2k4 UTSW 11 65696375 splice site probably benign
R4913:Map2k4 UTSW 11 65709932 missense probably damaging 1.00
R5452:Map2k4 UTSW 11 65719587 missense probably damaging 0.97
R5497:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5812:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5976:Map2k4 UTSW 11 65709952 missense probably benign 0.31
R6282:Map2k4 UTSW 11 65707016 missense possibly damaging 0.78
R6505:Map2k4 UTSW 11 65693529 missense possibly damaging 0.63
R6784:Map2k4 UTSW 11 65691751 unclassified probably benign
R7560:Map2k4 UTSW 11 65775757 missense unknown
R8071:Map2k4 UTSW 11 65707001 missense
Predicted Primers PCR Primer
(F):5'- ATGGCAGTCAGAAGCAGCAACC -3'
(R):5'- GTGGGCATAATTCTCAGAGCCTCAG -3'

Sequencing Primer
(F):5'- AGTCTAAACTTCAGTGGCATTCC -3'
(R):5'- CTCAGAGCCTCAGAGAGTTATTG -3'
Posted On2013-08-06