Mutagenetix > Incidental Mutation

Incidental Mutation 'R8361:Dhx36'

645953

Institutional Source

Beutler Lab

Gene Symbol

Dhx36

Ensembl Gene

ENSMUSG00000027770

Gene Name

DEAH-box helicase 36

Synonyms

2810407E23Rik, Ddx36, RHAU

MMRRC Submission

067735-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8361 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62375434-62414425 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 62388221 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000029336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029336]

AlphaFold

Q8VHK9

Predicted Effect

probably null
Transcript: ENSMUST00000029336

SMART Domains

Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770

Domain	Start	End	E-Value	Type
low complexity region	10	45	N/A	INTRINSIC
DEXDc	198	389	1.53e-31	SMART
HELICc	495	600	5.61e-16	SMART
HA2	662	753	2.23e-26	SMART
Pfam:OB_NTP_bind	792	910	1.2e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,632,153 (GRCm39)	N161S	possibly damaging	Het
Alg2	T	C	4: 47,471,848 (GRCm39)	Y320C	probably damaging	Het
Aox4	A	T	1: 58,279,998 (GRCm39)	E538V	probably benign	Het
Carmil1	A	C	13: 24,251,113 (GRCm39)		probably null	Het
Chrd	T	C	16: 20,557,487 (GRCm39)	F702S	possibly damaging	Het
Dnah5	G	T	15: 28,331,956 (GRCm39)	V2181L	probably damaging	Het
Dnajc11	C	A	4: 152,055,368 (GRCm39)	R229S	probably damaging	Het
Eml3	A	G	19: 8,914,801 (GRCm39)	N579D	possibly damaging	Het
Fam163b	G	A	2: 27,002,650 (GRCm39)	R116C	probably benign	Het
Fbxw2	A	G	2: 34,697,426 (GRCm39)	C314R	possibly damaging	Het
Gm4847	T	A	1: 166,469,839 (GRCm39)	H78L	possibly damaging	Het
Gtf2h3	T	C	5: 124,733,731 (GRCm39)	V268A	probably damaging	Het
Hmbox1	T	C	14: 65,134,289 (GRCm39)	S104G	possibly damaging	Het
Ighv1-36	T	A	12: 114,843,627 (GRCm39)	S78C	probably damaging	Het
Lrriq3	G	A	3: 154,806,855 (GRCm39)	W168*	probably null	Het
Mycbp2	A	G	14: 103,376,250 (GRCm39)	F3981S	probably damaging	Het
Or10k2	A	G	8: 84,268,715 (GRCm39)	H314R	possibly damaging	Het
Pias1	T	C	9: 62,826,668 (GRCm39)	T265A	possibly damaging	Het
Rxfp3	C	A	15: 11,036,784 (GRCm39)	R196L	probably benign	Het
Ryr3	A	G	2: 112,483,475 (GRCm39)	S4121P	probably damaging	Het
Safb2	T	C	17: 56,890,061 (GRCm39)	E61G	probably damaging	Het
Sestd1	A	T	2: 77,017,572 (GRCm39)	M665K	probably benign	Het
Slc3a1	C	T	17: 85,344,640 (GRCm39)	R269*	probably null	Het
Smurf1	T	A	5: 144,820,506 (GRCm39)	I521F	probably damaging	Het
Spink5	G	T	18: 44,122,529 (GRCm39)	L331F	probably damaging	Het
Stt3b	A	G	9: 115,083,988 (GRCm39)	I396T	probably damaging	Het
Uso1	A	G	5: 92,337,121 (GRCm39)	D635G	probably null	Het
Usp5	C	T	6: 124,801,948 (GRCm39)	G102D	probably damaging	Het
Zfp616	A	G	11: 73,975,476 (GRCm39)	R582G	probably damaging	Het
Zfp654	T	C	16: 64,612,220 (GRCm39)	H222R	probably damaging	Het

Other mutations in Dhx36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Dhx36	APN	3	62,377,979 (GRCm39)	utr 3 prime	probably benign
IGL00538:Dhx36	APN	3	62,408,466 (GRCm39)	missense	probably benign	0.04
IGL00706:Dhx36	APN	3	62,404,263 (GRCm39)	missense	probably damaging	1.00
IGL02040:Dhx36	APN	3	62,408,436 (GRCm39)	missense	probably benign
IGL02141:Dhx36	APN	3	62,401,310 (GRCm39)	missense	probably benign	0.25
IGL02514:Dhx36	APN	3	62,408,319 (GRCm39)	missense	possibly damaging	0.63
IGL02540:Dhx36	APN	3	62,414,309 (GRCm39)	missense	probably benign	0.07
IGL02629:Dhx36	APN	3	62,414,155 (GRCm39)	missense	probably benign	0.01
IGL02858:Dhx36	APN	3	62,384,797 (GRCm39)	splice site	probably benign
IGL03305:Dhx36	APN	3	62,408,257 (GRCm39)	nonsense	probably null
bundeswehr	UTSW	3	62,386,747 (GRCm39)	missense	probably benign
R0002:Dhx36	UTSW	3	62,388,260 (GRCm39)	missense	probably damaging	1.00
R0002:Dhx36	UTSW	3	62,388,260 (GRCm39)	missense	probably damaging	1.00
R0021:Dhx36	UTSW	3	62,385,016 (GRCm39)	missense	possibly damaging	0.66
R0021:Dhx36	UTSW	3	62,385,016 (GRCm39)	missense	possibly damaging	0.66
R0671:Dhx36	UTSW	3	62,401,162 (GRCm39)	missense	possibly damaging	0.96
R0735:Dhx36	UTSW	3	62,380,150 (GRCm39)	missense	probably benign	0.00
R0782:Dhx36	UTSW	3	62,414,135 (GRCm39)	splice site	probably benign
R1725:Dhx36	UTSW	3	62,414,360 (GRCm39)	start codon destroyed	probably benign	0.01
R1951:Dhx36	UTSW	3	62,391,694 (GRCm39)	missense	probably damaging	0.99
R1959:Dhx36	UTSW	3	62,386,806 (GRCm39)	missense	probably benign	0.01
R2257:Dhx36	UTSW	3	62,385,064 (GRCm39)	missense	probably damaging	1.00
R2397:Dhx36	UTSW	3	62,405,518 (GRCm39)	missense	probably benign	0.00
R2484:Dhx36	UTSW	3	62,380,236 (GRCm39)	missense	probably damaging	0.96
R2973:Dhx36	UTSW	3	62,402,919 (GRCm39)	missense	possibly damaging	0.56
R2973:Dhx36	UTSW	3	62,402,916 (GRCm39)	missense	probably benign	0.00
R3617:Dhx36	UTSW	3	62,394,481 (GRCm39)	missense	probably benign	0.01
R3617:Dhx36	UTSW	3	62,379,428 (GRCm39)	missense	possibly damaging	0.96
R3725:Dhx36	UTSW	3	62,395,643 (GRCm39)	splice site	probably benign
R3898:Dhx36	UTSW	3	62,399,790 (GRCm39)	missense	probably damaging	0.98
R4332:Dhx36	UTSW	3	62,392,412 (GRCm39)	missense	probably damaging	1.00
R4359:Dhx36	UTSW	3	62,382,699 (GRCm39)	missense	probably benign	0.05
R4493:Dhx36	UTSW	3	62,395,925 (GRCm39)	intron	probably benign
R4652:Dhx36	UTSW	3	62,408,419 (GRCm39)	missense	probably benign	0.01
R4866:Dhx36	UTSW	3	62,380,198 (GRCm39)	missense	probably damaging	1.00
R4884:Dhx36	UTSW	3	62,391,681 (GRCm39)	missense	probably damaging	1.00
R4960:Dhx36	UTSW	3	62,404,280 (GRCm39)	missense	probably damaging	1.00
R5083:Dhx36	UTSW	3	62,379,420 (GRCm39)	missense	probably benign	0.17
R5162:Dhx36	UTSW	3	62,401,201 (GRCm39)	missense	probably damaging	1.00
R5815:Dhx36	UTSW	3	62,401,176 (GRCm39)	missense	probably damaging	1.00
R6090:Dhx36	UTSW	3	62,404,241 (GRCm39)	missense	probably damaging	0.98
R6392:Dhx36	UTSW	3	62,401,790 (GRCm39)	missense	probably benign	0.00
R6433:Dhx36	UTSW	3	62,392,395 (GRCm39)	missense	probably damaging	1.00
R6504:Dhx36	UTSW	3	62,396,060 (GRCm39)	missense	probably benign
R6615:Dhx36	UTSW	3	62,396,338 (GRCm39)	missense	probably benign
R6672:Dhx36	UTSW	3	62,408,300 (GRCm39)	missense	probably benign	0.00
R6672:Dhx36	UTSW	3	62,402,957 (GRCm39)	missense	probably damaging	1.00
R7172:Dhx36	UTSW	3	62,408,436 (GRCm39)	missense	probably benign
R7302:Dhx36	UTSW	3	62,386,814 (GRCm39)	missense	probably benign
R7487:Dhx36	UTSW	3	62,391,623 (GRCm39)	missense	possibly damaging	0.91
R7515:Dhx36	UTSW	3	62,379,508 (GRCm39)	missense	probably benign	0.45
R7531:Dhx36	UTSW	3	62,392,389 (GRCm39)	missense	probably damaging	1.00
R7579:Dhx36	UTSW	3	62,388,294 (GRCm39)	missense	possibly damaging	0.64
R7726:Dhx36	UTSW	3	62,396,389 (GRCm39)	missense	probably benign	0.01
R7874:Dhx36	UTSW	3	62,396,052 (GRCm39)	missense	probably benign
R8056:Dhx36	UTSW	3	62,396,012 (GRCm39)	missense	possibly damaging	0.93
R8226:Dhx36	UTSW	3	62,377,991 (GRCm39)	missense	probably benign	0.01
R8529:Dhx36	UTSW	3	62,414,277 (GRCm39)	small deletion	probably benign
R8737:Dhx36	UTSW	3	62,386,747 (GRCm39)	missense	probably benign
R8947:Dhx36	UTSW	3	62,380,387 (GRCm39)	missense	probably benign
R9098:Dhx36	UTSW	3	62,414,142 (GRCm39)	missense	probably benign	0.00
R9098:Dhx36	UTSW	3	62,414,141 (GRCm39)	nonsense	probably null
R9209:Dhx36	UTSW	3	62,378,895 (GRCm39)	missense	probably benign	0.21
R9718:Dhx36	UTSW	3	62,379,466 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CCAAACATAGGCACCCTGAT -3'
(R):5'- CTTCCTTTGGTGTTCTAAAAGTTGTG -3'

Sequencing Primer
(F):5'- TTGACTAATCGCTGACCGCAG -3'
(R):5'- CTAAAAGTTGTGTTCTTGTCATTGC -3'

Posted On

2020-09-02