Incidental Mutation 'R8361:Dnajc11'
ID645956
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene NameDnaJ heat shock protein family (Hsp40) member C11
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R8361 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location151933691-151982137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 151970911 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 229 (R229S)
Ref Sequence ENSEMBL: ENSMUSP00000051643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062904] [ENSMUST00000139069] [ENSMUST00000147625]
Predicted Effect probably damaging
Transcript: ENSMUST00000062904
AA Change: R229S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: R229S

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139069
AA Change: R188S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768
AA Change: R188S

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147625
SMART Domains Protein: ENSMUSP00000122140
Gene: ENSMUSG00000039768

DomainStartEndE-ValueType
DnaJ 1 36 2.51e-1 SMART
low complexity region 64 84 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,582,153 N161S possibly damaging Het
Alg2 T C 4: 47,471,848 Y320C probably damaging Het
Aox4 A T 1: 58,240,839 E538V probably benign Het
Carmil1 A C 13: 24,067,130 probably null Het
Chrd T C 16: 20,738,737 F702S possibly damaging Het
Dhx36 A T 3: 62,480,800 probably null Het
Dnah5 G T 15: 28,331,810 V2181L probably damaging Het
Eml3 A G 19: 8,937,437 N579D possibly damaging Het
Fam163b G A 2: 27,112,638 R116C probably benign Het
Fbxw2 A G 2: 34,807,414 C314R possibly damaging Het
Gm4847 T A 1: 166,642,270 H78L possibly damaging Het
Gtf2h3 T C 5: 124,595,668 V268A probably damaging Het
Hmbox1 T C 14: 64,896,840 S104G possibly damaging Het
Ighv1-36 T A 12: 114,880,007 S78C probably damaging Het
Lrriq3 G A 3: 155,101,218 W168* probably null Het
Mycbp2 A G 14: 103,138,814 F3981S probably damaging Het
Olfr370 A G 8: 83,542,086 H314R possibly damaging Het
Pias1 T C 9: 62,919,386 T265A possibly damaging Het
Rxfp3 C A 15: 11,036,698 R196L probably benign Het
Ryr3 A G 2: 112,653,130 S4121P probably damaging Het
Safb2 T C 17: 56,583,061 E61G probably damaging Het
Sestd1 A T 2: 77,187,228 M665K probably benign Het
Slc3a1 C T 17: 85,037,212 R269* probably null Het
Smurf1 T A 5: 144,883,696 I521F probably damaging Het
Spink5 G T 18: 43,989,462 L331F probably damaging Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Uso1 A G 5: 92,189,262 D635G probably null Het
Usp5 C T 6: 124,824,985 G102D probably damaging Het
Zfp616 A G 11: 74,084,650 R582G probably damaging Het
Zfp654 T C 16: 64,791,857 H222R probably damaging Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 151979302 missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 151950519 nonsense probably null
IGL02606:Dnajc11 APN 4 151979484 missense probably benign 0.18
IGL02969:Dnajc11 APN 4 151978046 missense probably benign 0.33
IGL03062:Dnajc11 APN 4 151970861 missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 151952889 missense probably benign 0.04
R0601:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 151973628 missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 151979273 missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 151978093 unclassified probably benign
R4545:Dnajc11 UTSW 4 151979941 missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 151973617 missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 151968539 missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 151970967 unclassified probably benign
R4751:Dnajc11 UTSW 4 151968542 missense probably benign 0.01
R4895:Dnajc11 UTSW 4 151979933 missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 151976997 missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 151969814 unclassified probably benign
R5174:Dnajc11 UTSW 4 151979984 missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 151969939 missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 151968526 missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 151979510 missense probably benign
R6056:Dnajc11 UTSW 4 151978126 unclassified probably benign
R6434:Dnajc11 UTSW 4 151979294 missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 151968611 missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 151974225 missense probably damaging 0.99
R7937:Dnajc11 UTSW 4 151950452 missense probably damaging 1.00
R7940:Dnajc11 UTSW 4 151968588 missense probably benign 0.00
R8093:Dnajc11 UTSW 4 151969900 missense probably damaging 1.00
Z1176:Dnajc11 UTSW 4 151933783 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTAGGGGTCTGTCCAGC -3'
(R):5'- GATTAGAAGGCAAGTGGTCCC -3'

Sequencing Primer
(F):5'- TGTCCAGCCCTTGTCCAGAG -3'
(R):5'- GGCAAGTGGTCCCAAGTTG -3'
Posted On2020-09-02