Incidental Mutation 'R0034:Faap100'
ID64597
Institutional Source Beutler Lab
Gene Symbol Faap100
Ensembl Gene ENSMUSG00000025384
Gene NameFanconi anemia core complex associated protein 100
Synonyms2310003H01Rik
MMRRC Submission 038328-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R0034 (G1)
Quality Score133
Status Validated
Chromosome11
Chromosomal Location120369055-120378764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120372147 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 795 (M795K)
Ref Sequence ENSEMBL: ENSMUSP00000026448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026445] [ENSMUST00000026448]
Predicted Effect probably benign
Transcript: ENSMUST00000026445
SMART Domains Protein: ENSMUSP00000026445
Gene: ENSMUSG00000025380

DomainStartEndE-ValueType
Pfam:Fascin 20 133 4.9e-34 PFAM
Pfam:Fascin 141 254 1.2e-26 PFAM
Pfam:Fascin 266 376 8.9e-35 PFAM
Pfam:Fascin 389 492 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026448
AA Change: M795K

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384
AA Change: M795K

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154826
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP100 is a component of the Fanconi anemia (FA; MIM 277650) core complex and is required for core complex stability and FANCD2 (see MIM 227646) monoubiquitination (Ling et al., 2007 [PubMed 17396147]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C A 19: 7,420,359 H90Q probably damaging Het
4930402H24Rik T C 2: 130,736,572 H664R probably damaging Het
9430038I01Rik C T 7: 137,387,592 R60Q probably benign Het
Angpt4 C T 2: 151,929,391 T209I probably benign Het
Ap3b1 T C 13: 94,479,885 probably benign Het
Aplp1 A C 7: 30,444,442 V56G probably damaging Het
Asns G A 6: 7,676,299 P419L probably damaging Het
Atxn7 A T 14: 14,100,846 H844L probably damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cd300lb C T 11: 114,928,399 V135I probably damaging Het
Cep152 C T 2: 125,583,893 A851T probably benign Het
Cfap74 C T 4: 155,460,887 probably benign Het
Col28a1 T A 6: 8,175,708 I47L probably benign Het
Eef1d T C 15: 75,902,959 T200A probably benign Het
Gabpb1 C T 2: 126,658,534 R15Q possibly damaging Het
Gata4 C A 14: 63,201,484 M381I probably benign Het
Gm5114 A G 7: 39,408,858 S446P possibly damaging Het
Gm7271 A G 5: 76,516,530 I155M probably damaging Het
Gnb1 T A 4: 155,551,689 N155K probably benign Het
Haspin G A 11: 73,138,218 T15M probably damaging Het
Heatr5a A G 12: 51,925,172 L745P probably damaging Het
Kcng3 T A 17: 83,588,383 probably benign Het
Kif15 A T 9: 122,999,285 N887I possibly damaging Het
Kif26a T C 12: 112,168,963 probably benign Het
Kif9 G A 9: 110,519,611 C738Y probably benign Het
Kifc2 G T 15: 76,667,100 C613F probably benign Het
Klf12 A G 14: 99,987,429 probably null Het
Lrp1 A T 10: 127,545,651 I3826N probably benign Het
Map2k4 A G 11: 65,719,611 probably benign Het
Myo7b A G 18: 31,960,860 S2006P probably damaging Het
Olfr631 T C 7: 103,929,501 V226A probably benign Het
Pax4 T C 6: 28,442,449 T285A probably benign Het
Pcdhb5 A G 18: 37,322,084 N506D probably damaging Het
Pkhd1l1 G A 15: 44,504,009 G768S probably benign Het
Plb1 G T 5: 32,273,113 G138V probably benign Het
Poln A C 5: 34,115,418 V398G possibly damaging Het
Poteg A G 8: 27,462,077 probably benign Het
Rapgef1 C A 2: 29,724,768 probably benign Het
Rbm43 A T 2: 51,925,710 D166E probably benign Het
Rhobtb2 T C 14: 69,788,688 T602A probably benign Het
Samd3 G A 10: 26,271,500 probably benign Het
Sbno2 A C 10: 80,058,340 probably benign Het
Sec1 A G 7: 45,679,335 V96A probably benign Het
Senp7 A C 16: 56,153,570 S385R possibly damaging Het
Sgk3 T C 1: 9,885,677 V301A probably damaging Het
Sgpl1 A T 10: 61,102,613 M467K probably damaging Het
Slc22a26 A G 19: 7,802,253 I66T probably benign Het
Stra6 G A 9: 58,151,469 probably null Het
Tfrc T A 16: 32,615,396 probably null Het
Tmem30b T C 12: 73,546,005 Y112C probably damaging Het
Trap1 A T 16: 4,069,030 probably benign Het
Trpc1 A G 9: 95,749,761 S43P probably damaging Het
Tsku T C 7: 98,352,663 T154A possibly damaging Het
Uroc1 T C 6: 90,345,310 V272A probably damaging Het
Vmn1r69 T A 7: 10,580,811 probably benign Het
Vmn2r1 T A 3: 64,090,014 W364R probably damaging Het
Wnk2 G T 13: 49,068,080 T377K possibly damaging Het
Zscan20 T C 4: 128,585,662 N1012S probably damaging Het
Other mutations in Faap100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Faap100 APN 11 120372132 missense probably damaging 1.00
IGL02954:Faap100 APN 11 120372131 missense probably damaging 1.00
IGL02799:Faap100 UTSW 11 120370735 missense probably damaging 1.00
R0207:Faap100 UTSW 11 120374365 missense probably damaging 1.00
R0432:Faap100 UTSW 11 120373876 splice site probably benign
R0570:Faap100 UTSW 11 120374288 missense possibly damaging 0.87
R0748:Faap100 UTSW 11 120372171 missense probably damaging 0.97
R0782:Faap100 UTSW 11 120376704 critical splice donor site probably null
R1218:Faap100 UTSW 11 120378340 missense probably benign 0.06
R1612:Faap100 UTSW 11 120377088 missense probably damaging 1.00
R1720:Faap100 UTSW 11 120374581 missense probably damaging 1.00
R1758:Faap100 UTSW 11 120377233 missense probably damaging 0.99
R2881:Faap100 UTSW 11 120374359 missense probably damaging 1.00
R2893:Faap100 UTSW 11 120374625 missense probably damaging 1.00
R3969:Faap100 UTSW 11 120378705 start codon destroyed probably null 1.00
R4824:Faap100 UTSW 11 120375586 unclassified probably null
R4911:Faap100 UTSW 11 120372113 missense probably benign 0.37
R5152:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5155:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5327:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5328:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5386:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5480:Faap100 UTSW 11 120377113 missense probably damaging 1.00
R5541:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5629:Faap100 UTSW 11 120377011 missense probably damaging 1.00
R5911:Faap100 UTSW 11 120377132 missense possibly damaging 0.94
R6285:Faap100 UTSW 11 120376732 missense probably damaging 1.00
R6350:Faap100 UTSW 11 120374580 missense probably damaging 1.00
R6525:Faap100 UTSW 11 120378764 unclassified probably null
R7046:Faap100 UTSW 11 120377374 missense possibly damaging 0.94
R7539:Faap100 UTSW 11 120377638 missense possibly damaging 0.73
R7781:Faap100 UTSW 11 120374263 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCACAGGGGCTGACAGGACATC -3'
(R):5'- GCCTGTAGTTAGCACAGGAAGGAC -3'

Sequencing Primer
(F):5'- ACATCTGGAGGGGCATCTTG -3'
(R):5'- CTTCCTGTCATGGAGCCAAGTATAG -3'
Posted On2013-08-06