Incidental Mutation 'R8361:Spink5'
ID 645976
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Name serine peptidase inhibitor, Kazal type 5
Synonyms 2310065D10Rik, LEKT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8361 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 43963235-44022501 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43989462 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 331 (L331F)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
AlphaFold Q148R4
Predicted Effect probably damaging
Transcript: ENSMUST00000069245
AA Change: L331F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: L331F

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,582,153 N161S possibly damaging Het
Alg2 T C 4: 47,471,848 Y320C probably damaging Het
Aox4 A T 1: 58,240,839 E538V probably benign Het
Carmil1 A C 13: 24,067,130 probably null Het
Chrd T C 16: 20,738,737 F702S possibly damaging Het
Dhx36 A T 3: 62,480,800 probably null Het
Dnah5 G T 15: 28,331,810 V2181L probably damaging Het
Dnajc11 C A 4: 151,970,911 R229S probably damaging Het
Eml3 A G 19: 8,937,437 N579D possibly damaging Het
Fam163b G A 2: 27,112,638 R116C probably benign Het
Fbxw2 A G 2: 34,807,414 C314R possibly damaging Het
Gm4847 T A 1: 166,642,270 H78L possibly damaging Het
Gtf2h3 T C 5: 124,595,668 V268A probably damaging Het
Hmbox1 T C 14: 64,896,840 S104G possibly damaging Het
Ighv1-36 T A 12: 114,880,007 S78C probably damaging Het
Lrriq3 G A 3: 155,101,218 W168* probably null Het
Mycbp2 A G 14: 103,138,814 F3981S probably damaging Het
Olfr370 A G 8: 83,542,086 H314R possibly damaging Het
Pias1 T C 9: 62,919,386 T265A possibly damaging Het
Rxfp3 C A 15: 11,036,698 R196L probably benign Het
Ryr3 A G 2: 112,653,130 S4121P probably damaging Het
Safb2 T C 17: 56,583,061 E61G probably damaging Het
Sestd1 A T 2: 77,187,228 M665K probably benign Het
Slc3a1 C T 17: 85,037,212 R269* probably null Het
Smurf1 T A 5: 144,883,696 I521F probably damaging Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Uso1 A G 5: 92,189,262 D635G probably null Het
Usp5 C T 6: 124,824,985 G102D probably damaging Het
Zfp616 A G 11: 74,084,650 R582G probably damaging Het
Zfp654 T C 16: 64,791,857 H222R probably damaging Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7828:Spink5 UTSW 18 44010229 missense probably benign 0.15
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R8031:Spink5 UTSW 18 44010236 missense probably benign 0.07
R8198:Spink5 UTSW 18 43992880 missense probably benign 0.17
R8375:Spink5 UTSW 18 43990719 missense probably benign 0.01
R8684:Spink5 UTSW 18 44010238 missense probably benign 0.02
R8749:Spink5 UTSW 18 43989358 nonsense probably null
R8918:Spink5 UTSW 18 43967020 missense probably damaging 0.98
R9064:Spink5 UTSW 18 43967126 missense probably damaging 1.00
R9161:Spink5 UTSW 18 44014919 missense probably damaging 1.00
R9221:Spink5 UTSW 18 43986300 missense probably damaging 1.00
R9292:Spink5 UTSW 18 44015008 missense possibly damaging 0.91
R9545:Spink5 UTSW 18 44003195 missense possibly damaging 0.88
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGTGTCTAGCAAAGGAAAC -3'
(R):5'- TTGAAGCTTCCACCCTTGG -3'

Sequencing Primer
(F):5'- CGTGTCTAGCAAAGGAAACTAAAC -3'
(R):5'- ACCCTTGGCTCTGTATTACAAGAG -3'
Posted On 2020-09-02