Incidental Mutation 'R8362:Polr1a'
ID 645994
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Name polymerase (RNA) I polypeptide A
Synonyms RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission 067808-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8362 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 71909053-71984935 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71964667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1053 (V1053A)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296]
AlphaFold O35134
Predicted Effect probably benign
Transcript: ENSMUST00000055296
AA Change: V1053A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: V1053A

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T A 19: 8,890,031 (GRCm38) S65T probably damaging Het
Abcb1b A T 5: 8,798,758 (GRCm38) N6I probably benign Het
Abr A T 11: 76,479,128 (GRCm38) I145N probably benign Het
Alcam A T 16: 52,295,024 (GRCm38) Y244N probably damaging Het
Amotl1 G A 9: 14,644,922 (GRCm38) A36V probably benign Het
Ankrd11 A T 8: 122,892,058 (GRCm38) L1685Q probably damaging Het
Ascc3 A C 10: 50,642,596 (GRCm38) Q332H possibly damaging Het
Cdc42bpa C T 1: 180,162,125 (GRCm38) L1720F probably damaging Het
Clec4b1 T C 6: 123,050,643 (GRCm38) S20P probably benign Het
Cpt1a C T 19: 3,370,744 (GRCm38) R401* probably null Het
Dnah12 T A 14: 26,854,831 (GRCm38) Y3013N probably damaging Het
Dopey1 G A 9: 86,513,888 (GRCm38) R801H probably benign Het
Flywch1 G T 17: 23,756,708 (GRCm38) T520N probably damaging Het
Fndc1 A G 17: 7,782,375 (GRCm38) S190P unknown Het
Gabra1 G T 11: 42,176,004 (GRCm38) Q28K probably benign Het
Gm884 A G 11: 103,615,337 (GRCm38) V1935A probably benign Het
Gria2 T C 3: 80,707,890 (GRCm38) M428V possibly damaging Het
H13 T A 2: 152,686,391 (GRCm38) I220N unknown Het
Hars2 T A 18: 36,790,175 (GRCm38) F412L probably benign Het
Hecw2 A T 1: 54,040,491 (GRCm38) M1K probably null Het
Homer1 T A 13: 93,366,289 (GRCm38) S192T unknown Het
Itga2b T A 11: 102,461,363 (GRCm38) D464V probably damaging Het
Ivd T A 2: 118,877,941 (GRCm38) C379S probably damaging Het
Khdc3 A T 9: 73,103,566 (GRCm38) N233Y possibly damaging Het
Lrrfip1 T A 1: 91,053,701 (GRCm38) L15Q probably damaging Het
Megf8 C A 7: 25,340,518 (GRCm38) P986Q probably benign Het
Morc2b G T 17: 33,138,321 (GRCm38) T159K possibly damaging Het
Nudt5 A G 2: 5,853,511 (GRCm38) probably null Het
Olfr801 G T 10: 129,670,231 (GRCm38) A96E possibly damaging Het
Paqr5 A T 9: 61,972,663 (GRCm38) Y116* probably null Het
Pcnx A C 12: 81,967,056 (GRCm38) S623R Het
Ptprt A T 2: 161,551,747 (GRCm38) D1252E probably damaging Het
Qser1 A G 2: 104,789,901 (GRCm38) S189P probably damaging Het
Rasal1 C T 5: 120,675,420 (GRCm38) R620W probably damaging Het
Rbms1 C T 2: 60,962,739 (GRCm38) M9I probably benign Het
Ska3 T C 14: 57,816,648 (GRCm38) N282D probably benign Het
Slc25a24 T A 3: 109,158,562 (GRCm38) I245N possibly damaging Het
Slc26a4 C T 12: 31,544,507 (GRCm38) V281I probably benign Het
Smg8 A T 11: 87,078,055 (GRCm38) Y958* probably null Het
Spata31 A G 13: 64,922,230 (GRCm38) T731A possibly damaging Het
Spg11 G T 2: 122,118,361 (GRCm38) A3D unknown Het
Srgap1 A G 10: 121,855,478 (GRCm38) Y284H possibly damaging Het
Stt3b A G 9: 115,254,920 (GRCm38) I396T probably damaging Het
Tnxb A G 17: 34,712,972 (GRCm38) T2160A probably damaging Het
Tprgl G C 4: 154,160,358 (GRCm38) T91S possibly damaging Het
Ush2a G A 1: 188,957,453 (GRCm38) V5071I probably damaging Het
Vmn2r60 T A 7: 42,195,530 (GRCm38) N772K probably damaging Het
Vmn2r81 T A 10: 79,267,449 (GRCm38) W159R probably benign Het
Vmn2r93 G A 17: 18,326,091 (GRCm38) V742I probably benign Het
Zc3h13 C A 14: 75,324,469 (GRCm38) H654N unknown Het
Zfp516 T C 18: 82,986,894 (GRCm38) L641P probably benign Het
Zfp623 T C 15: 75,947,639 (GRCm38) V148A probably damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71,948,486 (GRCm38) missense probably benign 0.32
IGL01834:Polr1a APN 6 71,948,462 (GRCm38) missense probably benign
IGL01902:Polr1a APN 6 71,963,748 (GRCm38) missense probably damaging 1.00
IGL02101:Polr1a APN 6 71,950,802 (GRCm38) missense probably benign 0.00
IGL02325:Polr1a APN 6 71,920,657 (GRCm38) missense probably benign 0.38
IGL02398:Polr1a APN 6 71,936,556 (GRCm38) splice site probably benign
IGL02528:Polr1a APN 6 71,964,717 (GRCm38) missense probably benign
IGL02555:Polr1a APN 6 71,920,457 (GRCm38) missense probably damaging 0.98
IGL02613:Polr1a APN 6 71,967,320 (GRCm38) missense probably damaging 1.00
IGL02693:Polr1a APN 6 71,963,846 (GRCm38) splice site probably benign
IGL02892:Polr1a APN 6 71,931,696 (GRCm38) missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71,936,512 (GRCm38) missense probably benign
IGL03174:Polr1a APN 6 71,977,347 (GRCm38) missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71,941,417 (GRCm38) missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71,967,455 (GRCm38) splice site probably benign
R0217:Polr1a UTSW 6 71,963,703 (GRCm38) missense probably benign 0.19
R0267:Polr1a UTSW 6 71,974,139 (GRCm38) missense probably damaging 0.99
R0329:Polr1a UTSW 6 71,966,416 (GRCm38) missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71,966,416 (GRCm38) missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71,920,763 (GRCm38) splice site probably benign
R0411:Polr1a UTSW 6 71,978,421 (GRCm38) missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71,950,664 (GRCm38) critical splice donor site probably null
R0846:Polr1a UTSW 6 71,924,643 (GRCm38) missense probably damaging 1.00
R1035:Polr1a UTSW 6 71,967,916 (GRCm38) missense probably benign
R1294:Polr1a UTSW 6 71,912,902 (GRCm38) missense probably damaging 0.99
R1460:Polr1a UTSW 6 71,941,384 (GRCm38) missense probably damaging 0.99
R1657:Polr1a UTSW 6 71,941,535 (GRCm38) missense probably damaging 1.00
R1846:Polr1a UTSW 6 71,976,188 (GRCm38) missense probably damaging 0.98
R1862:Polr1a UTSW 6 71,909,203 (GRCm38) missense probably damaging 0.96
R1865:Polr1a UTSW 6 71,966,524 (GRCm38) missense probably damaging 1.00
R1903:Polr1a UTSW 6 71,967,914 (GRCm38) missense probably benign 0.02
R1937:Polr1a UTSW 6 71,936,552 (GRCm38) critical splice donor site probably null
R2063:Polr1a UTSW 6 71,936,285 (GRCm38) splice site probably null
R2071:Polr1a UTSW 6 71,976,074 (GRCm38) missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71,950,809 (GRCm38) missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71,972,826 (GRCm38) critical splice donor site probably null
R2410:Polr1a UTSW 6 71,974,882 (GRCm38) missense probably benign
R3001:Polr1a UTSW 6 71,913,016 (GRCm38) missense probably benign 0.01
R3001:Polr1a UTSW 6 71,965,644 (GRCm38) missense probably benign 0.02
R3002:Polr1a UTSW 6 71,965,644 (GRCm38) missense probably benign 0.02
R3002:Polr1a UTSW 6 71,913,016 (GRCm38) missense probably benign 0.01
R3924:Polr1a UTSW 6 71,929,450 (GRCm38) missense probably benign 0.00
R4105:Polr1a UTSW 6 71,976,191 (GRCm38) missense probably damaging 0.98
R4125:Polr1a UTSW 6 71,965,706 (GRCm38) missense probably benign 0.00
R4271:Polr1a UTSW 6 71,953,022 (GRCm38) missense probably benign 0.02
R4440:Polr1a UTSW 6 71,950,848 (GRCm38) missense probably damaging 0.98
R4667:Polr1a UTSW 6 71,917,821 (GRCm38) missense probably benign 0.30
R4769:Polr1a UTSW 6 71,950,868 (GRCm38) missense probably benign 0.01
R4801:Polr1a UTSW 6 71,976,070 (GRCm38) missense probably benign 0.00
R4802:Polr1a UTSW 6 71,976,070 (GRCm38) missense probably benign 0.00
R4828:Polr1a UTSW 6 71,966,401 (GRCm38) missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71,909,229 (GRCm38) missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71,931,709 (GRCm38) missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71,967,925 (GRCm38) missense probably damaging 1.00
R5223:Polr1a UTSW 6 71,967,907 (GRCm38) missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71,913,037 (GRCm38) missense probably damaging 1.00
R5546:Polr1a UTSW 6 71,929,366 (GRCm38) missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71,967,362 (GRCm38) missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71,929,426 (GRCm38) missense probably benign 0.05
R5850:Polr1a UTSW 6 71,926,683 (GRCm38) missense probably benign 0.00
R6274:Polr1a UTSW 6 71,954,890 (GRCm38) splice site probably null
R6526:Polr1a UTSW 6 71,929,443 (GRCm38) missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71,976,041 (GRCm38) missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71,967,374 (GRCm38) missense probably damaging 0.98
R6892:Polr1a UTSW 6 71,964,712 (GRCm38) missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71,920,516 (GRCm38) nonsense probably null
R7291:Polr1a UTSW 6 71,941,456 (GRCm38) missense probably benign 0.02
R7311:Polr1a UTSW 6 71,950,879 (GRCm38) missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71,926,659 (GRCm38) missense probably benign 0.14
R7479:Polr1a UTSW 6 71,936,297 (GRCm38) missense probably damaging 1.00
R7607:Polr1a UTSW 6 71,913,021 (GRCm38) missense probably benign
R7739:Polr1a UTSW 6 71,954,835 (GRCm38) missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71,941,512 (GRCm38) missense probably damaging 1.00
R7764:Polr1a UTSW 6 71,953,070 (GRCm38) missense probably damaging 1.00
R7835:Polr1a UTSW 6 71,915,142 (GRCm38) missense probably benign 0.02
R8029:Polr1a UTSW 6 71,912,956 (GRCm38) nonsense probably null
R8057:Polr1a UTSW 6 71,931,660 (GRCm38) missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71,950,616 (GRCm38) missense probably benign
R8170:Polr1a UTSW 6 71,920,749 (GRCm38) missense probably benign
R8320:Polr1a UTSW 6 71,941,384 (GRCm38) missense probably damaging 0.99
R8328:Polr1a UTSW 6 71,920,734 (GRCm38) missense probably benign
R8331:Polr1a UTSW 6 71,976,179 (GRCm38) missense probably damaging 1.00
R8511:Polr1a UTSW 6 71,920,520 (GRCm38) missense probably benign 0.01
R8709:Polr1a UTSW 6 71,974,848 (GRCm38) missense probably benign
R8745:Polr1a UTSW 6 71,954,771 (GRCm38) missense probably damaging 1.00
R8784:Polr1a UTSW 6 71,950,628 (GRCm38) missense probably benign
R9055:Polr1a UTSW 6 71,915,069 (GRCm38) missense possibly damaging 0.46
R9088:Polr1a UTSW 6 71,931,783 (GRCm38) missense probably benign 0.26
R9211:Polr1a UTSW 6 71,966,537 (GRCm38) missense probably damaging 1.00
R9228:Polr1a UTSW 6 71,954,771 (GRCm38) missense probably damaging 1.00
R9240:Polr1a UTSW 6 71,963,677 (GRCm38) nonsense probably null
R9267:Polr1a UTSW 6 71,965,558 (GRCm38) missense probably benign
R9302:Polr1a UTSW 6 71,924,699 (GRCm38) critical splice donor site probably null
R9744:Polr1a UTSW 6 71,929,388 (GRCm38) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATTAAGCTCTCACTCCTGGC -3'
(R):5'- TTTCACAGCTGCCTGGATC -3'

Sequencing Primer
(F):5'- ACGTGCACCTGTCCCAGTAC -3'
(R):5'- CTGCCTGGATCTTCTGGGAAAAAC -3'
Posted On 2020-09-02