Incidental Mutation 'R8362:Zfp623'
ID 646020
Institutional Source Beutler Lab
Gene Symbol Zfp623
Ensembl Gene ENSMUSG00000050846
Gene Name zinc finger protein 623
Synonyms 2610029D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock # R8362 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 75940952-75949400 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75947639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000036049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037260]
AlphaFold Q9CY99
Predicted Effect probably damaging
Transcript: ENSMUST00000037260
AA Change: V148A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036049
Gene: ENSMUSG00000050846
AA Change: V148A

DomainStartEndE-ValueType
ZnF_C2H2 119 141 5.59e-4 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
ZnF_C2H2 175 197 2.4e-3 SMART
ZnF_C2H2 203 225 6.42e-4 SMART
ZnF_C2H2 231 253 1.3e-4 SMART
ZnF_C2H2 259 281 1.3e-4 SMART
ZnF_C2H2 287 309 1.28e-3 SMART
ZnF_C2H2 315 337 3.21e-4 SMART
ZnF_C2H2 343 365 3.39e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 399 421 2.53e-2 SMART
ZnF_C2H2 427 449 3.95e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T A 19: 8,890,031 S65T probably damaging Het
Abcb1b A T 5: 8,798,758 N6I probably benign Het
Abr A T 11: 76,479,128 I145N probably benign Het
Alcam A T 16: 52,295,024 Y244N probably damaging Het
Amotl1 G A 9: 14,644,922 A36V probably benign Het
Ankrd11 A T 8: 122,892,058 L1685Q probably damaging Het
Ascc3 A C 10: 50,642,596 Q332H possibly damaging Het
Cdc42bpa C T 1: 180,162,125 L1720F probably damaging Het
Clec4b1 T C 6: 123,050,643 S20P probably benign Het
Cpt1a C T 19: 3,370,744 R401* probably null Het
Dnah12 T A 14: 26,854,831 Y3013N probably damaging Het
Dopey1 G A 9: 86,513,888 R801H probably benign Het
Flywch1 G T 17: 23,756,708 T520N probably damaging Het
Fndc1 A G 17: 7,782,375 S190P unknown Het
Gabra1 G T 11: 42,176,004 Q28K probably benign Het
Gm884 A G 11: 103,615,337 V1935A probably benign Het
Gria2 T C 3: 80,707,890 M428V possibly damaging Het
H13 T A 2: 152,686,391 I220N unknown Het
Hars2 T A 18: 36,790,175 F412L probably benign Het
Hecw2 A T 1: 54,040,491 M1K probably null Het
Homer1 T A 13: 93,366,289 S192T unknown Het
Itga2b T A 11: 102,461,363 D464V probably damaging Het
Ivd T A 2: 118,877,941 C379S probably damaging Het
Khdc3 A T 9: 73,103,566 N233Y possibly damaging Het
Lrrfip1 T A 1: 91,053,701 L15Q probably damaging Het
Megf8 C A 7: 25,340,518 P986Q probably benign Het
Morc2b G T 17: 33,138,321 T159K possibly damaging Het
Nudt5 A G 2: 5,853,511 probably null Het
Olfr801 G T 10: 129,670,231 A96E possibly damaging Het
Paqr5 A T 9: 61,972,663 Y116* probably null Het
Pcnx A C 12: 81,967,056 S623R Het
Polr1a T C 6: 71,964,667 V1053A probably benign Het
Ptprt A T 2: 161,551,747 D1252E probably damaging Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rasal1 C T 5: 120,675,420 R620W probably damaging Het
Rbms1 C T 2: 60,962,739 M9I probably benign Het
Ska3 T C 14: 57,816,648 N282D probably benign Het
Slc25a24 T A 3: 109,158,562 I245N possibly damaging Het
Slc26a4 C T 12: 31,544,507 V281I probably benign Het
Smg8 A T 11: 87,078,055 Y958* probably null Het
Spata31 A G 13: 64,922,230 T731A possibly damaging Het
Spg11 G T 2: 122,118,361 A3D unknown Het
Srgap1 A G 10: 121,855,478 Y284H possibly damaging Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Tnxb A G 17: 34,712,972 T2160A probably damaging Het
Tprgl G C 4: 154,160,358 T91S possibly damaging Het
Ush2a G A 1: 188,957,453 V5071I probably damaging Het
Vmn2r60 T A 7: 42,195,530 N772K probably damaging Het
Vmn2r81 T A 10: 79,267,449 W159R probably benign Het
Vmn2r93 G A 17: 18,326,091 V742I probably benign Het
Zc3h13 C A 14: 75,324,469 H654N unknown Het
Zfp516 T C 18: 82,986,894 L641P probably benign Het
Other mutations in Zfp623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp623 APN 15 75948203 missense probably damaging 1.00
IGL01524:Zfp623 APN 15 75947679 missense probably benign
IGL01927:Zfp623 APN 15 75947505 missense possibly damaging 0.57
IGL03199:Zfp623 APN 15 75947270 missense probably benign 0.40
R0076:Zfp623 UTSW 15 75947209 missense probably benign
R0352:Zfp623 UTSW 15 75948584 missense probably benign 0.00
R0360:Zfp623 UTSW 15 75948661 missense probably benign
R0364:Zfp623 UTSW 15 75948661 missense probably benign
R1783:Zfp623 UTSW 15 75947911 missense probably damaging 0.99
R2219:Zfp623 UTSW 15 75947530 missense possibly damaging 0.90
R5975:Zfp623 UTSW 15 75948163 missense probably benign 0.43
R6161:Zfp623 UTSW 15 75948621 missense probably benign 0.22
R6342:Zfp623 UTSW 15 75947988 nonsense probably null
R6490:Zfp623 UTSW 15 75948459 missense probably damaging 1.00
R6513:Zfp623 UTSW 15 75947468 missense probably benign
R7028:Zfp623 UTSW 15 75948305 missense probably damaging 0.99
R7399:Zfp623 UTSW 15 75947398 missense probably damaging 0.98
R7716:Zfp623 UTSW 15 75948422 missense probably damaging 1.00
R8445:Zfp623 UTSW 15 75947553 nonsense probably null
R9028:Zfp623 UTSW 15 75947500 missense probably damaging 0.97
R9035:Zfp623 UTSW 15 75948313 missense possibly damaging 0.93
R9310:Zfp623 UTSW 15 75948100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCATAGATGCGGAGGC -3'
(R):5'- GCGGATAAGGCTTGAACTCC -3'

Sequencing Primer
(F):5'- AGGCCCGTTCCTGTGGTG -3'
(R):5'- CTTGAACTCCGAATGAAGGATTTCCC -3'
Posted On 2020-09-02