Incidental Mutation 'R8362:Cpt1a'
ID646029
Institutional Source Beutler Lab
Gene Symbol Cpt1a
Ensembl Gene ENSMUSG00000024900
Gene Namecarnitine palmitoyltransferase 1a, liver
SynonymsL-CPT I, CPTI, Cpt1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8362 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3323301-3385732 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 3370744 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 401 (R401*)
Ref Sequence ENSEMBL: ENSMUSP00000025835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025835]
Predicted Effect probably null
Transcript: ENSMUST00000025835
AA Change: R401*
SMART Domains Protein: ENSMUSP00000025835
Gene: ENSMUSG00000024900
AA Change: R401*

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-30 PFAM
transmembrane domain 49 71 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 762 6e-186 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display decreased serum glucose and increased serum free fatty acid levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T A 19: 8,890,031 S65T probably damaging Het
Abcb1b A T 5: 8,798,758 N6I probably benign Het
Abr A T 11: 76,479,128 I145N probably benign Het
Alcam A T 16: 52,295,024 Y244N probably damaging Het
Amotl1 G A 9: 14,644,922 A36V probably benign Het
Ankrd11 A T 8: 122,892,058 L1685Q probably damaging Het
Ascc3 A C 10: 50,642,596 Q332H possibly damaging Het
Cdc42bpa C T 1: 180,162,125 L1720F probably damaging Het
Clec4b1 T C 6: 123,050,643 S20P probably benign Het
Dnah12 T A 14: 26,854,831 Y3013N probably damaging Het
Dopey1 G A 9: 86,513,888 R801H probably benign Het
Flywch1 G T 17: 23,756,708 T520N probably damaging Het
Fndc1 A G 17: 7,782,375 S190P unknown Het
Gabra1 G T 11: 42,176,004 Q28K probably benign Het
Gm884 A G 11: 103,615,337 V1935A probably benign Het
Gria2 T C 3: 80,707,890 M428V possibly damaging Het
H13 T A 2: 152,686,391 I220N unknown Het
Hars2 T A 18: 36,790,175 F412L probably benign Het
Hecw2 A T 1: 54,040,491 M1K probably null Het
Homer1 T A 13: 93,366,289 S192T unknown Het
Itga2b T A 11: 102,461,363 D464V probably damaging Het
Ivd T A 2: 118,877,941 C379S probably damaging Het
Khdc3 A T 9: 73,103,566 N233Y possibly damaging Het
Lrrfip1 T A 1: 91,053,701 L15Q probably damaging Het
Megf8 C A 7: 25,340,518 P986Q probably benign Het
Morc2b G T 17: 33,138,321 T159K possibly damaging Het
Nudt5 A G 2: 5,853,511 probably null Het
Olfr801 G T 10: 129,670,231 A96E possibly damaging Het
Paqr5 A T 9: 61,972,663 Y116* probably null Het
Pcnx A C 12: 81,967,056 S623R Het
Polr1a T C 6: 71,964,667 V1053A probably benign Het
Ptprt A T 2: 161,551,747 D1252E probably damaging Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rasal1 C T 5: 120,675,420 R620W probably damaging Het
Rbms1 C T 2: 60,962,739 M9I probably benign Het
Ska3 T C 14: 57,816,648 N282D probably benign Het
Slc25a24 T A 3: 109,158,562 I245N possibly damaging Het
Slc26a4 C T 12: 31,544,507 V281I probably benign Het
Smg8 A T 11: 87,078,055 Y958* probably null Het
Spata31 A G 13: 64,922,230 T731A possibly damaging Het
Spg11 G T 2: 122,118,361 A3D unknown Het
Srgap1 A G 10: 121,855,478 Y284H possibly damaging Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Tnxb A G 17: 34,712,972 T2160A probably damaging Het
Tprgl G C 4: 154,160,358 T91S possibly damaging Het
Ush2a G A 1: 188,957,453 V5071I probably damaging Het
Vmn2r60 T A 7: 42,195,530 N772K probably damaging Het
Vmn2r81 T A 10: 79,267,449 W159R probably benign Het
Vmn2r93 G A 17: 18,326,091 V742I probably benign Het
Zc3h13 C A 14: 75,324,469 H654N unknown Het
Zfp516 T C 18: 82,986,894 L641P probably benign Het
Zfp623 T C 15: 75,947,639 V148A probably damaging Het
Other mutations in Cpt1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Cpt1a APN 19 3366389 missense possibly damaging 0.85
allosouris UTSW 19 3378472 missense probably damaging 1.00
Tyrannosouris UTSW 19 3362156 missense probably damaging 1.00
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0305:Cpt1a UTSW 19 3378455 missense probably benign
R0963:Cpt1a UTSW 19 3381634 missense probably damaging 1.00
R1511:Cpt1a UTSW 19 3365788 splice site probably benign
R2102:Cpt1a UTSW 19 3371585 missense probably benign 0.25
R3034:Cpt1a UTSW 19 3378390 missense probably damaging 1.00
R3153:Cpt1a UTSW 19 3356430 missense probably damaging 0.99
R5195:Cpt1a UTSW 19 3383800 missense possibly damaging 0.88
R5391:Cpt1a UTSW 19 3349260 missense probably damaging 0.98
R5964:Cpt1a UTSW 19 3365760 missense possibly damaging 0.80
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6246:Cpt1a UTSW 19 3376550 missense probably damaging 0.99
R6339:Cpt1a UTSW 19 3362152 missense probably benign 0.27
R6427:Cpt1a UTSW 19 3362156 missense probably damaging 1.00
R6535:Cpt1a UTSW 19 3365788 splice site probably null
R6621:Cpt1a UTSW 19 3378472 missense probably damaging 1.00
R6892:Cpt1a UTSW 19 3371660 missense probably benign 0.00
R7142:Cpt1a UTSW 19 3375100 missense probably benign 0.00
R7385:Cpt1a UTSW 19 3380155 missense probably damaging 0.99
R7908:Cpt1a UTSW 19 3362202 missense probably benign 0.26
R8098:Cpt1a UTSW 19 3370849 missense probably benign
R8444:Cpt1a UTSW 19 3381981 missense probably benign
X0019:Cpt1a UTSW 19 3366348 missense probably benign 0.01
Z1177:Cpt1a UTSW 19 3366370 missense probably damaging 1.00
Z1177:Cpt1a UTSW 19 3370727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTTGGATTTCATTCTGAGC -3'
(R):5'- CCATAGCAGGGGTCAGATTTG -3'

Sequencing Primer
(F):5'- TGACCTGTCTGGCTAACAAG -3'
(R):5'- AGGCTGCTCACAGGTACC -3'
Posted On2020-09-02