Incidental Mutation 'R8363:Vps16'
ID646038
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene NameVSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8363 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130424339-130444269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130442241 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 665 (F665L)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
Predicted Effect probably benign
Transcript: ENSMUST00000028900
AA Change: F665L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: F665L

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,170 I375L Het
Adamts18 C T 8: 113,767,163 G448D probably damaging Het
Bzw2 A G 12: 36,130,123 V35A probably benign Het
C2cd4d C T 3: 94,363,850 T141M probably benign Het
Cbwd1 A T 19: 24,942,727 H175Q probably benign Het
Chchd4 T A 6: 91,467,755 K17* probably null Het
Cmas C T 6: 142,756,828 P19L probably benign Het
Colec10 A G 15: 54,410,842 H22R probably benign Het
D630045J12Rik T C 6: 38,148,441 D1546G probably damaging Het
Dgki A T 6: 37,016,678 C583S probably damaging Het
Dhrs13 G T 11: 78,034,517 V205L probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Erc1 T C 6: 119,753,299 D612G probably benign Het
Fam163b G A 2: 27,112,638 R116C probably benign Het
Gm5160 T C 18: 14,424,872 V2A possibly damaging Het
Gm8247 A T 14: 44,586,462 I202F Het
Gm8994 T G 6: 136,329,455 S305A probably benign Het
Gnpat T C 8: 124,863,299 V21A probably benign Het
Igfn1 A T 1: 135,963,887 S2297T probably benign Het
Igkv13-85 A G 6: 68,930,285 Y111H probably damaging Het
Il17rd A G 14: 27,091,949 N206D probably damaging Het
Il1r2 G A 1: 40,120,935 V272M probably damaging Het
Ivl T A 3: 92,572,218 H180L possibly damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kirrel2 A G 7: 30,453,543 V350A probably damaging Het
Marc2 A G 1: 184,833,858 probably null Het
Mcpt4 A G 14: 56,062,235 S14P probably damaging Het
Mdm2 A G 10: 117,690,334 V449A probably damaging Het
Mga T C 2: 119,963,926 V2697A probably benign Het
Mlxipl T C 5: 135,107,076 F52L probably benign Het
Ndst3 T C 3: 123,556,868 S623G possibly damaging Het
Oas1a C T 5: 120,905,839 A77T probably damaging Het
Olfr459 T C 6: 41,771,750 Q183R probably benign Het
Olfr464 A T 11: 87,914,243 I221N probably damaging Het
P3h2 A G 16: 25,992,718 F252L probably damaging Het
Psme4 A G 11: 30,812,139 D493G probably damaging Het
Rab3ip A C 10: 116,918,964 I229S probably damaging Het
Ralgapb T C 2: 158,426,199 L74P probably damaging Het
Scn1a G T 2: 66,322,257 N804K probably damaging Het
Slc22a6 A T 19: 8,619,022 H124L probably benign Het
Slc6a6 A G 6: 91,750,296 I492V probably benign Het
Snx2 G T 18: 53,197,864 E134* probably null Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Tcp11 A G 17: 28,069,247 S415P possibly damaging Het
Vmn2r67 A T 7: 85,155,761 S48T probably benign Het
Wdhd1 A T 14: 47,276,532 D22E probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCATCTCTAGGACAGTG -3'
(R):5'- GCCTCCAAGGATAAGAGTGGTG -3'

Sequencing Primer
(F):5'- CAGTGGAAGAGTGCCCCTAG -3'
(R):5'- TCGTGTAGAGATAGGTCTAGGAACC -3'
Posted On2020-09-02