Incidental Mutation 'R8363:Slc6a6'
ID 646050
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms Taut
MMRRC Submission 067654-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8363 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 91661031-91736044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91727277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 492 (I492V)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
AlphaFold O35316
Predicted Effect probably benign
Transcript: ENSMUST00000032185
AA Change: I492V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: I492V

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,055,800 (GRCm39) I375L Het
Adamts18 C T 8: 114,493,795 (GRCm39) G448D probably damaging Het
Bzw2 A G 12: 36,180,122 (GRCm39) V35A probably benign Het
C2cd4d C T 3: 94,271,157 (GRCm39) T141M probably benign Het
Chchd4 T A 6: 91,444,737 (GRCm39) K17* probably null Het
Cmas C T 6: 142,702,554 (GRCm39) P19L probably benign Het
Colec10 A G 15: 54,274,238 (GRCm39) H22R probably benign Het
D630045J12Rik T C 6: 38,125,376 (GRCm39) D1546G probably damaging Het
Dgki A T 6: 36,993,613 (GRCm39) C583S probably damaging Het
Dhrs13 G T 11: 77,925,343 (GRCm39) V205L probably damaging Het
Eif4a3l1 T G 6: 136,306,453 (GRCm39) S305A probably benign Het
Eppk1 C T 15: 75,994,319 (GRCm39) R854Q probably benign Het
Erc1 T C 6: 119,730,260 (GRCm39) D612G probably benign Het
Fam163b G A 2: 27,002,650 (GRCm39) R116C probably benign Het
Gm5160 T C 18: 14,557,929 (GRCm39) V2A possibly damaging Het
Gm8247 A T 14: 44,823,919 (GRCm39) I202F Het
Gnpat T C 8: 125,590,038 (GRCm39) V21A probably benign Het
Igfn1 A T 1: 135,891,625 (GRCm39) S2297T probably benign Het
Igkv13-85 A G 6: 68,907,269 (GRCm39) Y111H probably damaging Het
Il17rd A G 14: 26,813,906 (GRCm39) N206D probably damaging Het
Il1r2 G A 1: 40,160,095 (GRCm39) V272M probably damaging Het
Ivl T A 3: 92,479,525 (GRCm39) H180L possibly damaging Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Kirrel2 A G 7: 30,152,968 (GRCm39) V350A probably damaging Het
Mcpt4 A G 14: 56,299,692 (GRCm39) S14P probably damaging Het
Mdm2 A G 10: 117,526,239 (GRCm39) V449A probably damaging Het
Mga T C 2: 119,794,407 (GRCm39) V2697A probably benign Het
Mlxipl T C 5: 135,135,930 (GRCm39) F52L probably benign Het
Mtarc2 A G 1: 184,566,055 (GRCm39) probably null Het
Ndst3 T C 3: 123,350,517 (GRCm39) S623G possibly damaging Het
Oas1a C T 5: 121,043,902 (GRCm39) A77T probably damaging Het
Or4d1 A T 11: 87,805,069 (GRCm39) I221N probably damaging Het
Or9a2 T C 6: 41,748,684 (GRCm39) Q183R probably benign Het
P3h2 A G 16: 25,811,468 (GRCm39) F252L probably damaging Het
Psme4 A G 11: 30,762,139 (GRCm39) D493G probably damaging Het
Rab3ip A C 10: 116,754,869 (GRCm39) I229S probably damaging Het
Ralgapb T C 2: 158,268,119 (GRCm39) L74P probably damaging Het
Scn1a G T 2: 66,152,601 (GRCm39) N804K probably damaging Het
Slc22a6 A T 19: 8,596,386 (GRCm39) H124L probably benign Het
Snx2 G T 18: 53,330,936 (GRCm39) E134* probably null Het
Stt3b A G 9: 115,083,988 (GRCm39) I396T probably damaging Het
Tcp11 A G 17: 28,288,221 (GRCm39) S415P possibly damaging Het
Vmn2r67 A T 7: 84,804,969 (GRCm39) S48T probably benign Het
Vps16 T A 2: 130,284,161 (GRCm39) F665L probably benign Het
Wdhd1 A T 14: 47,513,989 (GRCm39) D22E probably damaging Het
Zng1 A T 19: 24,920,091 (GRCm39) H175Q probably benign Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91,718,151 (GRCm39) intron probably benign
IGL01829:Slc6a6 APN 6 91,712,170 (GRCm39) missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91,703,050 (GRCm39) missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91,712,160 (GRCm39) missense probably benign
IGL02301:Slc6a6 APN 6 91,703,037 (GRCm39) missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91,726,808 (GRCm39) missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91,725,311 (GRCm39) unclassified probably benign
animas UTSW 6 91,716,995 (GRCm39) splice site probably null
customary UTSW 6 91,703,224 (GRCm39) nonsense probably null
durango UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
habit UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R5861_Slc6a6_905 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6665_Slc6a6_931 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R0530:Slc6a6 UTSW 6 91,701,939 (GRCm39) missense probably null 0.04
R1327:Slc6a6 UTSW 6 91,703,016 (GRCm39) missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91,717,973 (GRCm39) missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91,718,008 (GRCm39) missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91,701,891 (GRCm39) missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91,712,161 (GRCm39) missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91,703,177 (GRCm39) missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91,712,193 (GRCm39) missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91,718,029 (GRCm39) missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3403:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3978:Slc6a6 UTSW 6 91,732,033 (GRCm39) missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91,718,257 (GRCm39) missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91,703,041 (GRCm39) missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91,712,155 (GRCm39) missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91,721,981 (GRCm39) missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91,700,298 (GRCm39) missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91,731,929 (GRCm39) missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91,716,995 (GRCm39) splice site probably null
R6262:Slc6a6 UTSW 6 91,732,013 (GRCm39) missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91,731,896 (GRCm39) missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91,729,419 (GRCm39) missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91,718,248 (GRCm39) missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91,701,832 (GRCm39) missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91,716,946 (GRCm39) missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91,718,226 (GRCm39) missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91,703,087 (GRCm39) missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91,701,951 (GRCm39) missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91,703,224 (GRCm39) nonsense probably null
R8836:Slc6a6 UTSW 6 91,725,444 (GRCm39) missense probably damaging 0.96
R9102:Slc6a6 UTSW 6 91,731,940 (GRCm39) missense probably benign 0.10
R9257:Slc6a6 UTSW 6 91,716,952 (GRCm39) missense possibly damaging 0.74
R9511:Slc6a6 UTSW 6 91,721,921 (GRCm39) missense probably damaging 1.00
R9526:Slc6a6 UTSW 6 91,726,808 (GRCm39) missense probably benign 0.02
R9701:Slc6a6 UTSW 6 91,700,478 (GRCm39) missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91,700,457 (GRCm39) missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91,718,205 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGGGATTAGCCATGC -3'
(R):5'- GTCCCAGGTATAGCTGAAGC -3'

Sequencing Primer
(F):5'- TAGCCATGCTAAGATGTGGACTC -3'
(R):5'- GAAAATGTCACGCTCAGG -3'
Posted On 2020-09-02