Incidental Mutation 'R8363:Erc1'
ID646051
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene NameELKS/RAB6-interacting/CAST family member 1
SynonymsB430107L16Rik, Rab6ip2, 5033405M01Rik, RAB6IP2A, 9630025C19Rik, RAB6IP2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8363 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location119570796-119848167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119753299 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 612 (D612G)
Ref Sequence ENSEMBL: ENSMUSP00000032279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
Predicted Effect probably benign
Transcript: ENSMUST00000032279
AA Change: D612G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: D612G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183703
AA Change: D612G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: D612G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183880
AA Change: D584G

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172
AA Change: D584G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183911
AA Change: D584G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: D584G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184838
AA Change: D612G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172
AA Change: D612G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184864
AA Change: D612G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: D612G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185139
AA Change: D584G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: D584G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185143
AA Change: D312G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172
AA Change: D312G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,170 I375L Het
Adamts18 C T 8: 113,767,163 G448D probably damaging Het
Bzw2 A G 12: 36,130,123 V35A probably benign Het
C2cd4d C T 3: 94,363,850 T141M probably benign Het
Cbwd1 A T 19: 24,942,727 H175Q probably benign Het
Chchd4 T A 6: 91,467,755 K17* probably null Het
Cmas C T 6: 142,756,828 P19L probably benign Het
Colec10 A G 15: 54,410,842 H22R probably benign Het
D630045J12Rik T C 6: 38,148,441 D1546G probably damaging Het
Dgki A T 6: 37,016,678 C583S probably damaging Het
Dhrs13 G T 11: 78,034,517 V205L probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fam163b G A 2: 27,112,638 R116C probably benign Het
Gm5160 T C 18: 14,424,872 V2A possibly damaging Het
Gm8247 A T 14: 44,586,462 I202F Het
Gm8994 T G 6: 136,329,455 S305A probably benign Het
Gnpat T C 8: 124,863,299 V21A probably benign Het
Igfn1 A T 1: 135,963,887 S2297T probably benign Het
Igkv13-85 A G 6: 68,930,285 Y111H probably damaging Het
Il17rd A G 14: 27,091,949 N206D probably damaging Het
Il1r2 G A 1: 40,120,935 V272M probably damaging Het
Ivl T A 3: 92,572,218 H180L possibly damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kirrel2 A G 7: 30,453,543 V350A probably damaging Het
Marc2 A G 1: 184,833,858 probably null Het
Mcpt4 A G 14: 56,062,235 S14P probably damaging Het
Mdm2 A G 10: 117,690,334 V449A probably damaging Het
Mga T C 2: 119,963,926 V2697A probably benign Het
Mlxipl T C 5: 135,107,076 F52L probably benign Het
Ndst3 T C 3: 123,556,868 S623G possibly damaging Het
Oas1a C T 5: 120,905,839 A77T probably damaging Het
Olfr459 T C 6: 41,771,750 Q183R probably benign Het
Olfr464 A T 11: 87,914,243 I221N probably damaging Het
P3h2 A G 16: 25,992,718 F252L probably damaging Het
Psme4 A G 11: 30,812,139 D493G probably damaging Het
Rab3ip A C 10: 116,918,964 I229S probably damaging Het
Ralgapb T C 2: 158,426,199 L74P probably damaging Het
Scn1a G T 2: 66,322,257 N804K probably damaging Het
Slc22a6 A T 19: 8,619,022 H124L probably benign Het
Slc6a6 A G 6: 91,750,296 I492V probably benign Het
Snx2 G T 18: 53,197,864 E134* probably null Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Tcp11 A G 17: 28,069,247 S415P possibly damaging Het
Vmn2r67 A T 7: 85,155,761 S48T probably benign Het
Vps16 T A 2: 130,442,241 F665L probably benign Het
Wdhd1 A T 14: 47,276,532 D22E probably damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119722303 missense probably damaging 0.96
IGL01345:Erc1 APN 6 119761263 nonsense probably null
IGL01370:Erc1 APN 6 119824465 missense probably damaging 1.00
IGL01443:Erc1 APN 6 119824471 missense probably damaging 1.00
IGL01550:Erc1 APN 6 119783394 missense probably damaging 0.96
IGL01798:Erc1 APN 6 119620337 missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119630609 missense probably damaging 1.00
IGL02239:Erc1 APN 6 119773891 missense probably damaging 0.96
IGL02341:Erc1 APN 6 119594973 missense possibly damaging 0.92
couch UTSW 6 119743429 missense possibly damaging 0.81
divan UTSW 6 119753288 missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119779491 missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119824830 missense probably damaging 1.00
R0277:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R0323:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R1053:Erc1 UTSW 6 119796926 missense probably damaging 1.00
R1252:Erc1 UTSW 6 119743392 missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119743420 nonsense probably null
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1680:Erc1 UTSW 6 119575761 missense probably damaging 1.00
R1833:Erc1 UTSW 6 119743429 missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119797305 missense probably damaging 1.00
R2037:Erc1 UTSW 6 119722255 missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119575695 missense probably damaging 1.00
R3751:Erc1 UTSW 6 119824960 missense probably damaging 0.99
R4473:Erc1 UTSW 6 119848456 splice site probably null
R4778:Erc1 UTSW 6 119797337 splice site probably null
R4897:Erc1 UTSW 6 119777986 critical splice donor site probably null
R5260:Erc1 UTSW 6 119761159 missense probably damaging 1.00
R5382:Erc1 UTSW 6 119761272 missense probably benign 0.02
R5405:Erc1 UTSW 6 119824944 missense probably damaging 1.00
R5801:Erc1 UTSW 6 119773822 missense probably damaging 0.99
R6341:Erc1 UTSW 6 119777998 missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119575726 missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119824951 missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119594946 nonsense probably null
R7532:Erc1 UTSW 6 119779631 missense probably benign 0.02
R7575:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7576:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119824603 missense probably benign 0.33
R7740:Erc1 UTSW 6 119761188 missense probably benign 0.02
R7789:Erc1 UTSW 6 119773709 nonsense probably null
R7805:Erc1 UTSW 6 119713771 missense possibly damaging 0.85
R7833:Erc1 UTSW 6 119824486 nonsense probably null
R8039:Erc1 UTSW 6 119773665 nonsense probably null
R8229:Erc1 UTSW 6 119753288 missense probably benign 0.27
R8794:Erc1 UTSW 6 119630655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCCAGAAGTTGGTGCTAAG -3'
(R):5'- ACAAAATTTTGGCTGCTGTAGGG -3'

Sequencing Primer
(F):5'- CCCAGAAGTTGGTGCTAAGATCTAAG -3'
(R):5'- GCAGATGAGCAGCTTGAA -3'
Posted On2020-09-02