Incidental Mutation 'R8363:Olfr464'
ID646064
Institutional Source Beutler Lab
Gene Symbol Olfr464
Ensembl Gene ENSMUSG00000060787
Gene Nameolfactory receptor 464
SynonymsMOR240-2, GA_x6K02T2PAEV-9555122-9554181
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R8363 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87913268-87920967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87914243 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 221 (I221N)
Ref Sequence ENSEMBL: ENSMUSP00000149777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074874] [ENSMUST00000216461] [ENSMUST00000217112]
Predicted Effect probably damaging
Transcript: ENSMUST00000074874
AA Change: I221N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074415
Gene: ENSMUSG00000060787
AA Change: I221N

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.3e-42 PFAM
Pfam:7tm_1 41 287 3.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216461
AA Change: I221N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217112
AA Change: I221N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,170 I375L Het
Adamts18 C T 8: 113,767,163 G448D probably damaging Het
Bzw2 A G 12: 36,130,123 V35A probably benign Het
C2cd4d C T 3: 94,363,850 T141M probably benign Het
Cbwd1 A T 19: 24,942,727 H175Q probably benign Het
Chchd4 T A 6: 91,467,755 K17* probably null Het
Cmas C T 6: 142,756,828 P19L probably benign Het
Colec10 A G 15: 54,410,842 H22R probably benign Het
D630045J12Rik T C 6: 38,148,441 D1546G probably damaging Het
Dgki A T 6: 37,016,678 C583S probably damaging Het
Dhrs13 G T 11: 78,034,517 V205L probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Erc1 T C 6: 119,753,299 D612G probably benign Het
Fam163b G A 2: 27,112,638 R116C probably benign Het
Gm5160 T C 18: 14,424,872 V2A possibly damaging Het
Gm8247 A T 14: 44,586,462 I202F Het
Gm8994 T G 6: 136,329,455 S305A probably benign Het
Gnpat T C 8: 124,863,299 V21A probably benign Het
Igfn1 A T 1: 135,963,887 S2297T probably benign Het
Igkv13-85 A G 6: 68,930,285 Y111H probably damaging Het
Il17rd A G 14: 27,091,949 N206D probably damaging Het
Il1r2 G A 1: 40,120,935 V272M probably damaging Het
Ivl T A 3: 92,572,218 H180L possibly damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kirrel2 A G 7: 30,453,543 V350A probably damaging Het
Marc2 A G 1: 184,833,858 probably null Het
Mcpt4 A G 14: 56,062,235 S14P probably damaging Het
Mdm2 A G 10: 117,690,334 V449A probably damaging Het
Mga T C 2: 119,963,926 V2697A probably benign Het
Mlxipl T C 5: 135,107,076 F52L probably benign Het
Ndst3 T C 3: 123,556,868 S623G possibly damaging Het
Oas1a C T 5: 120,905,839 A77T probably damaging Het
Olfr459 T C 6: 41,771,750 Q183R probably benign Het
P3h2 A G 16: 25,992,718 F252L probably damaging Het
Psme4 A G 11: 30,812,139 D493G probably damaging Het
Rab3ip A C 10: 116,918,964 I229S probably damaging Het
Ralgapb T C 2: 158,426,199 L74P probably damaging Het
Scn1a G T 2: 66,322,257 N804K probably damaging Het
Slc22a6 A T 19: 8,619,022 H124L probably benign Het
Slc6a6 A G 6: 91,750,296 I492V probably benign Het
Snx2 G T 18: 53,197,864 E134* probably null Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Tcp11 A G 17: 28,069,247 S415P possibly damaging Het
Vmn2r67 A T 7: 85,155,761 S48T probably benign Het
Vps16 T A 2: 130,442,241 F665L probably benign Het
Wdhd1 A T 14: 47,276,532 D22E probably damaging Het
Other mutations in Olfr464
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr464 APN 11 87914172 missense probably benign 0.09
IGL02011:Olfr464 APN 11 87914882 missense probably benign 0.01
IGL02218:Olfr464 APN 11 87914063 missense probably damaging 1.00
IGL02977:Olfr464 APN 11 87914130 missense possibly damaging 0.48
IGL03083:Olfr464 APN 11 87914088 missense probably benign 0.00
IGL03154:Olfr464 APN 11 87914246 missense possibly damaging 0.90
R0241:Olfr464 UTSW 11 87914034 missense probably damaging 1.00
R0241:Olfr464 UTSW 11 87914034 missense probably damaging 1.00
R4679:Olfr464 UTSW 11 87914310 missense probably benign 0.13
R4734:Olfr464 UTSW 11 87914190 missense probably damaging 1.00
R4939:Olfr464 UTSW 11 87914124 missense probably damaging 1.00
R5917:Olfr464 UTSW 11 87914389 missense probably damaging 1.00
R6729:Olfr464 UTSW 11 87914850 nonsense probably null
R8289:Olfr464 UTSW 11 87914763 missense probably benign 0.07
R8328:Olfr464 UTSW 11 87914159 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTGAGCGTGTAGATCATGGG -3'
(R):5'- ATTGTCCAGCTGTCTCTGATGC -3'

Sequencing Primer
(F):5'- AGATCATGGGGTTGAGCATG -3'
(R):5'- TGATGCTTCCACTGCCG -3'
Posted On2020-09-02