Incidental Mutation 'R8363:Snx2'
ID646075
Institutional Source Beutler Lab
Gene Symbol Snx2
Ensembl Gene ENSMUSG00000034484
Gene Namesorting nexin 2
Synonyms0610030A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8363 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location53176365-53220860 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 53197864 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 134 (E134*)
Ref Sequence ENSEMBL: ENSMUSP00000039243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037850]
Predicted Effect probably null
Transcript: ENSMUST00000037850
AA Change: E134*
SMART Domains Protein: ENSMUSP00000039243
Gene: ENSMUSG00000034484
AA Change: E134*

DomainStartEndE-ValueType
Pfam:Sorting_nexin 2 134 1.6e-29 PFAM
PX 138 265 1.4e-38 SMART
Pfam:Vps5 281 514 2.2e-90 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the sorting nexin family whose members contain the phosphoinositide-binding phox (PX) domain. The encoded protein is a component of the retromer complex which plays a role in protein sorting in the endocytic pathway. This protein may form oligomeric complexes with other family members. Alternate splicing results in multiple transcript variants of this gene. Pseudogenes associated with this gene are located on chromosomes 1 and 7. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,170 I375L Het
Adamts18 C T 8: 113,767,163 G448D probably damaging Het
Bzw2 A G 12: 36,130,123 V35A probably benign Het
C2cd4d C T 3: 94,363,850 T141M probably benign Het
Cbwd1 A T 19: 24,942,727 H175Q probably benign Het
Chchd4 T A 6: 91,467,755 K17* probably null Het
Cmas C T 6: 142,756,828 P19L probably benign Het
Colec10 A G 15: 54,410,842 H22R probably benign Het
D630045J12Rik T C 6: 38,148,441 D1546G probably damaging Het
Dgki A T 6: 37,016,678 C583S probably damaging Het
Dhrs13 G T 11: 78,034,517 V205L probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Erc1 T C 6: 119,753,299 D612G probably benign Het
Fam163b G A 2: 27,112,638 R116C probably benign Het
Gm5160 T C 18: 14,424,872 V2A possibly damaging Het
Gm8247 A T 14: 44,586,462 I202F Het
Gm8994 T G 6: 136,329,455 S305A probably benign Het
Gnpat T C 8: 124,863,299 V21A probably benign Het
Igfn1 A T 1: 135,963,887 S2297T probably benign Het
Igkv13-85 A G 6: 68,930,285 Y111H probably damaging Het
Il17rd A G 14: 27,091,949 N206D probably damaging Het
Il1r2 G A 1: 40,120,935 V272M probably damaging Het
Ivl T A 3: 92,572,218 H180L possibly damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kirrel2 A G 7: 30,453,543 V350A probably damaging Het
Marc2 A G 1: 184,833,858 probably null Het
Mcpt4 A G 14: 56,062,235 S14P probably damaging Het
Mdm2 A G 10: 117,690,334 V449A probably damaging Het
Mga T C 2: 119,963,926 V2697A probably benign Het
Mlxipl T C 5: 135,107,076 F52L probably benign Het
Ndst3 T C 3: 123,556,868 S623G possibly damaging Het
Oas1a C T 5: 120,905,839 A77T probably damaging Het
Olfr459 T C 6: 41,771,750 Q183R probably benign Het
Olfr464 A T 11: 87,914,243 I221N probably damaging Het
P3h2 A G 16: 25,992,718 F252L probably damaging Het
Psme4 A G 11: 30,812,139 D493G probably damaging Het
Rab3ip A C 10: 116,918,964 I229S probably damaging Het
Ralgapb T C 2: 158,426,199 L74P probably damaging Het
Scn1a G T 2: 66,322,257 N804K probably damaging Het
Slc22a6 A T 19: 8,619,022 H124L probably benign Het
Slc6a6 A G 6: 91,750,296 I492V probably benign Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Tcp11 A G 17: 28,069,247 S415P possibly damaging Het
Vmn2r67 A T 7: 85,155,761 S48T probably benign Het
Vps16 T A 2: 130,442,241 F665L probably benign Het
Wdhd1 A T 14: 47,276,532 D22E probably damaging Het
Other mutations in Snx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Snx2 APN 18 53216400 missense possibly damaging 0.95
IGL00861:Snx2 APN 18 53210797 splice site probably null
IGL01116:Snx2 APN 18 53194423 splice site probably benign
IGL01642:Snx2 APN 18 53216447 missense probably damaging 0.99
IGL02178:Snx2 APN 18 53199785 missense possibly damaging 0.61
IGL02368:Snx2 APN 18 53189721 missense probably benign
IGL02597:Snx2 APN 18 53210372 missense probably benign 0.09
IGL02964:Snx2 APN 18 53194558 missense probably benign 0.00
IGL03372:Snx2 APN 18 53216391 missense probably damaging 1.00
blanched UTSW 18 53194444 missense probably damaging 0.98
bleached UTSW 18 53197925 splice site probably null
R0332:Snx2 UTSW 18 53212911 missense probably benign 0.01
R0723:Snx2 UTSW 18 53210372 missense probably benign 0.09
R0746:Snx2 UTSW 18 53197889 missense possibly damaging 0.90
R0826:Snx2 UTSW 18 53194522 missense probably benign 0.00
R0894:Snx2 UTSW 18 53176416 missense probably benign
R0970:Snx2 UTSW 18 53210690 splice site probably benign
R1897:Snx2 UTSW 18 53197878 missense probably damaging 0.99
R2049:Snx2 UTSW 18 53194444 missense probably damaging 0.98
R2910:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R2911:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R4460:Snx2 UTSW 18 53176444 missense probably benign 0.31
R5225:Snx2 UTSW 18 53189712 missense possibly damaging 0.91
R5352:Snx2 UTSW 18 53197925 splice site probably null
R5450:Snx2 UTSW 18 53210712 missense probably damaging 0.99
R5576:Snx2 UTSW 18 53210750 missense probably benign 0.33
R5965:Snx2 UTSW 18 53194462 nonsense probably null
R6063:Snx2 UTSW 18 53209625 nonsense probably null
R6222:Snx2 UTSW 18 53199824 nonsense probably null
R6291:Snx2 UTSW 18 53209665 critical splice donor site probably null
R6890:Snx2 UTSW 18 53212879 missense probably damaging 1.00
R7380:Snx2 UTSW 18 53194568 missense probably benign
R8081:Snx2 UTSW 18 53216387 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAAAATAGTAGGGTCTGTATATCTGGA -3'
(R):5'- TGTGTGTAAGACCTGGCATT -3'

Sequencing Primer
(F):5'- TGCAAAAAGTAGCTTCTTCGGCG -3'
(R):5'- GGATGTAACAATCAAGCTAGT -3'
Posted On2020-09-02