Incidental Mutation 'R8364:Stxbp1'
ID646082
Institutional Source Beutler Lab
Gene Symbol Stxbp1
Ensembl Gene ENSMUSG00000026797
Gene Namesyntaxin binding protein 1
SynonymsRb-sec1, Munc18-1, Munc-18a, Sxtbp1, Unc18h, N-sec1, nsec1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R8364 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32787602-32847245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32806762 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 330 (M330V)
Ref Sequence ENSEMBL: ENSMUSP00000089051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458]
Predicted Effect probably damaging
Transcript: ENSMUST00000050000
AA Change: M330V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797
AA Change: M330V

DomainStartEndE-ValueType
Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000077458
AA Change: M330V

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: M330V

DomainStartEndE-ValueType
Pfam:Sec1 29 581 2.8e-110 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T A 1: 89,887,674 N761K probably damaging Het
Amotl1 G A 9: 14,644,922 A36V probably benign Het
Apol7a A G 15: 77,389,620 V214A possibly damaging Het
Arhgef25 G T 10: 127,189,763 Q3K unknown Het
Bpifc A T 10: 85,962,027 I456N probably damaging Het
Cers6 C T 2: 68,861,739 A35V possibly damaging Het
Corin T A 5: 72,304,931 Y986F probably benign Het
Csmd3 A T 15: 48,673,441 Y122N probably damaging Het
Ddit4l T A 3: 137,624,235 L18* probably null Het
Epb41l3 T C 17: 69,266,434 probably null Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Greb1l G T 18: 10,529,687 V890L possibly damaging Het
Hivep3 A T 4: 120,099,442 M1652L probably benign Het
Ighv1-19 G T 12: 114,708,926 Q25K possibly damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Krr1 A G 10: 111,977,199 R160G probably damaging Het
Lama3 A G 18: 12,528,347 D515G probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lgalsl T A 11: 20,831,009 M1L possibly damaging Het
Lrtm2 T A 6: 119,317,298 T291S probably benign Het
Morc2b G A 17: 33,138,240 T186I probably benign Het
Mup20 G T 4: 62,051,531 S157R probably damaging Het
Nlgn1 A G 3: 25,435,976 V529A probably benign Het
Nps T A 7: 135,268,814 W22R probably benign Het
Nradd C A 9: 110,621,468 V214L probably damaging Het
Ogfrl1 G A 1: 23,375,743 Q228* probably null Het
Olfr1029 G A 2: 85,976,014 C257Y possibly damaging Het
Olfr681 T A 7: 105,121,703 I82N probably damaging Het
Olfr979 T C 9: 40,000,364 T288A probably benign Het
Ripor2 A G 13: 24,710,193 T735A possibly damaging Het
Rnase6 C A 14: 51,130,453 P101T probably benign Het
Slc34a2 A T 5: 53,068,374 Y455F possibly damaging Het
Ssfa2 T C 2: 79,651,443 L489P probably damaging Het
Sypl2 T C 3: 108,217,734 T104A possibly damaging Het
Tenm4 G A 7: 96,772,106 probably null Het
Tnfrsf11a C A 1: 105,817,687 T150K probably damaging Het
Tpsg1 T C 17: 25,374,256 L311P possibly damaging Het
Ttc7b T C 12: 100,325,558 S766G probably benign Het
Vmn2r83 A G 10: 79,480,203 T478A probably benign Het
Wdr1 G A 5: 38,527,849 T593I possibly damaging Het
Zfp407 A G 18: 84,552,868 probably null Het
Zfp872 G A 9: 22,200,244 G340R probably damaging Het
Other mutations in Stxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Stxbp1 APN 2 32812064 missense probably benign 0.00
IGL02743:Stxbp1 APN 2 32819901 missense probably damaging 0.98
volume UTSW 2 32801893 missense probably damaging 0.99
volume2 UTSW 2 32801883 missense possibly damaging 0.95
P0021:Stxbp1 UTSW 2 32823538 missense probably damaging 0.96
R0217:Stxbp1 UTSW 2 32801870 missense possibly damaging 0.69
R0269:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0285:Stxbp1 UTSW 2 32823542 missense probably benign 0.00
R0335:Stxbp1 UTSW 2 32802905 splice site probably benign
R0565:Stxbp1 UTSW 2 32819848 missense probably benign 0.07
R0617:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0690:Stxbp1 UTSW 2 32800695 splice site probably benign
R1022:Stxbp1 UTSW 2 32814967 splice site probably null
R1024:Stxbp1 UTSW 2 32814967 splice site probably null
R1295:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1296:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1472:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1699:Stxbp1 UTSW 2 32800617 missense probably damaging 0.99
R1744:Stxbp1 UTSW 2 32806719 critical splice donor site probably null
R2004:Stxbp1 UTSW 2 32798189 missense probably damaging 0.99
R2151:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2153:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2154:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R5170:Stxbp1 UTSW 2 32794674 missense probably benign 0.01
R6083:Stxbp1 UTSW 2 32796018 missense possibly damaging 0.95
R6295:Stxbp1 UTSW 2 32794609 missense probably damaging 0.98
R6504:Stxbp1 UTSW 2 32801883 missense possibly damaging 0.95
R6770:Stxbp1 UTSW 2 32819889 missense probably benign 0.01
R6954:Stxbp1 UTSW 2 32801893 missense probably damaging 0.99
R7283:Stxbp1 UTSW 2 32815014 missense probably damaging 1.00
R7382:Stxbp1 UTSW 2 32798168 missense probably damaging 1.00
R7541:Stxbp1 UTSW 2 32818505 missense probably damaging 0.99
R7734:Stxbp1 UTSW 2 32801820 missense probably benign 0.00
R8462:Stxbp1 UTSW 2 32817281 splice site probably null
RF010:Stxbp1 UTSW 2 32821915 missense probably benign 0.06
X0060:Stxbp1 UTSW 2 32802768 missense probably damaging 1.00
Z1177:Stxbp1 UTSW 2 32802754 missense probably null 1.00
Z1177:Stxbp1 UTSW 2 32809128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTAATGTCCTTGCACCTTTATGG -3'
(R):5'- GTGAGTGGACACTTGTAAAGTCTAATG -3'

Sequencing Primer
(F):5'- AGTAGGAAGCAGTCTCCCTTC -3'
(R):5'- AAAGTCTAATGTAGCTGCTCTCCTG -3'
Posted On2020-09-02