Incidental Mutation 'R8364:Slc34a2'
ID 646093
Institutional Source Beutler Lab
Gene Symbol Slc34a2
Ensembl Gene ENSMUSG00000029188
Gene Name solute carrier family 34 (sodium phosphate), member 2
Synonyms D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b
MMRRC Submission
Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8364 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 53038081-53071664 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53068374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 455 (Y455F)
Ref Sequence ENSEMBL: ENSMUSP00000092380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094787]
AlphaFold Q9DBP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000094787
AA Change: Y455F

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: Y455F

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 252 2.3e-26 PFAM
Pfam:Na_Pi_cotrans 374 551 2.6e-17 PFAM
low complexity region 553 570 N/A INTRINSIC
low complexity region 616 645 N/A INTRINSIC
low complexity region 649 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T A 1: 89,887,674 N761K probably damaging Het
Amotl1 G A 9: 14,644,922 A36V probably benign Het
Apol7a A G 15: 77,389,620 V214A possibly damaging Het
Arhgef25 G T 10: 127,189,763 Q3K unknown Het
Bpifc A T 10: 85,962,027 I456N probably damaging Het
Cers6 C T 2: 68,861,739 A35V possibly damaging Het
Corin T A 5: 72,304,931 Y986F probably benign Het
Csmd3 A T 15: 48,673,441 Y122N probably damaging Het
Ddit4l T A 3: 137,624,235 L18* probably null Het
Epb41l3 T C 17: 69,266,434 probably null Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Greb1l G T 18: 10,529,687 V890L possibly damaging Het
Hivep3 A T 4: 120,099,442 M1652L probably benign Het
Ighv1-19 G T 12: 114,708,926 Q25K possibly damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Krr1 A G 10: 111,977,199 R160G probably damaging Het
Lama3 A G 18: 12,528,347 D515G probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lgalsl T A 11: 20,831,009 M1L possibly damaging Het
Lrtm2 T A 6: 119,317,298 T291S probably benign Het
Morc2b G A 17: 33,138,240 T186I probably benign Het
Mup20 G T 4: 62,051,531 S157R probably damaging Het
Nlgn1 A G 3: 25,435,976 V529A probably benign Het
Nps T A 7: 135,268,814 W22R probably benign Het
Nradd C A 9: 110,621,468 V214L probably damaging Het
Ogfrl1 G A 1: 23,375,743 Q228* probably null Het
Olfr1029 G A 2: 85,976,014 C257Y possibly damaging Het
Olfr681 T A 7: 105,121,703 I82N probably damaging Het
Olfr979 T C 9: 40,000,364 T288A probably benign Het
Ripor2 A G 13: 24,710,193 T735A possibly damaging Het
Rnase6 C A 14: 51,130,453 P101T probably benign Het
Ssfa2 T C 2: 79,651,443 L489P probably damaging Het
Stxbp1 T C 2: 32,806,762 M330V possibly damaging Het
Sypl2 T C 3: 108,217,734 T104A possibly damaging Het
Tenm4 G A 7: 96,772,106 probably null Het
Tnfrsf11a C A 1: 105,817,687 T150K probably damaging Het
Tpsg1 T C 17: 25,374,256 L311P possibly damaging Het
Ttc7b T C 12: 100,325,558 S766G probably benign Het
Vmn2r83 A G 10: 79,480,203 T478A probably benign Het
Wdr1 G A 5: 38,527,849 T593I possibly damaging Het
Zfp407 A G 18: 84,552,868 probably null Het
Zfp872 G A 9: 22,200,244 G340R probably damaging Het
Other mutations in Slc34a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Slc34a2 APN 5 53065608 missense probably benign 0.06
IGL00845:Slc34a2 APN 5 53058354 splice site probably benign
IGL01024:Slc34a2 APN 5 53067630 missense possibly damaging 0.61
IGL01300:Slc34a2 APN 5 53068127 critical splice acceptor site probably null
IGL01680:Slc34a2 APN 5 53060876 missense probably damaging 1.00
IGL02226:Slc34a2 APN 5 53067731 missense probably benign 0.12
IGL02682:Slc34a2 APN 5 53059238 missense possibly damaging 0.64
IGL03294:Slc34a2 APN 5 53063998 missense probably benign 0.00
tucumcari UTSW 5 53064009 missense possibly damaging 0.68
D4216:Slc34a2 UTSW 5 53065497 missense probably benign 0.01
R0094:Slc34a2 UTSW 5 53063968 missense probably benign 0.28
R0227:Slc34a2 UTSW 5 53069626 missense possibly damaging 0.51
R0524:Slc34a2 UTSW 5 53064873 nonsense probably null
R0836:Slc34a2 UTSW 5 53067707 missense probably benign
R1525:Slc34a2 UTSW 5 53069506 missense probably benign 0.00
R1655:Slc34a2 UTSW 5 53069419 missense probably benign 0.00
R1753:Slc34a2 UTSW 5 53061391 missense probably benign 0.37
R1838:Slc34a2 UTSW 5 53058436 missense probably benign
R2361:Slc34a2 UTSW 5 53068145 missense probably benign 0.10
R2405:Slc34a2 UTSW 5 53058181 missense probably benign 0.04
R3688:Slc34a2 UTSW 5 53064832 missense probably benign 0.06
R4108:Slc34a2 UTSW 5 53064009 missense possibly damaging 0.68
R4176:Slc34a2 UTSW 5 53067568 missense probably damaging 1.00
R4380:Slc34a2 UTSW 5 53069286 missense probably damaging 1.00
R4464:Slc34a2 UTSW 5 53069182 missense probably damaging 0.99
R4780:Slc34a2 UTSW 5 53069451 missense probably damaging 1.00
R4816:Slc34a2 UTSW 5 53069020 missense probably damaging 1.00
R4934:Slc34a2 UTSW 5 53067600 missense probably damaging 1.00
R5265:Slc34a2 UTSW 5 53061434 missense probably damaging 0.96
R5309:Slc34a2 UTSW 5 53069488 missense probably damaging 0.96
R5313:Slc34a2 UTSW 5 53069339 missense probably damaging 0.96
R5884:Slc34a2 UTSW 5 53069380 missense possibly damaging 0.46
R6084:Slc34a2 UTSW 5 53067647 missense possibly damaging 0.91
R6310:Slc34a2 UTSW 5 53064797 critical splice acceptor site probably null
R6568:Slc34a2 UTSW 5 53069134 missense probably damaging 1.00
R6817:Slc34a2 UTSW 5 53064028 missense probably damaging 0.98
R6845:Slc34a2 UTSW 5 53069169 missense probably damaging 0.96
R6944:Slc34a2 UTSW 5 53064883 missense probably benign
R7873:Slc34a2 UTSW 5 53058372 missense probably benign 0.02
R8114:Slc34a2 UTSW 5 53068359 missense probably benign 0.00
R8158:Slc34a2 UTSW 5 53060840 missense probably damaging 1.00
R9158:Slc34a2 UTSW 5 53063875 missense possibly damaging 0.95
R9235:Slc34a2 UTSW 5 53069325 missense probably benign 0.00
R9314:Slc34a2 UTSW 5 53060801 missense possibly damaging 0.61
Z1176:Slc34a2 UTSW 5 53060817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGCAGCTCTGTGTTCACG -3'
(R):5'- TGCATGGCTCTCACTAGAAAATAG -3'

Sequencing Primer
(F):5'- GTGTTCACGTCTGCCATGAC -3'
(R):5'- CCTTATGAATTTGGGGCCAGC -3'
Posted On 2020-09-02