Mutagenetix > Incidental Mutation

Incidental Mutation 'R8364:Lars2'

646103

Institutional Source

Beutler Lab

Gene Symbol

Lars2

Ensembl Gene

ENSMUSG00000035202

Gene Name

leucyl-tRNA synthetase, mitochondrial

Synonyms

Kiaa0028

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8364 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123366927-123462666 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 123411954 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 229 (G229*)

Ref Sequence

ENSEMBL: ENSMUSP00000036710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000217116]

AlphaFold

Q8VDC0

Predicted Effect

probably null
Transcript: ENSMUST00000038863
AA Change: G229*

SMART Domains

Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: G229*

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	57	223	7.6e-24	PFAM
Pfam:tRNA-synt_1g	83	239	9.3e-20	PFAM
Pfam:tRNA-synt_1_2	269	430	1.1e-8	PFAM
Pfam:tRNA-synt_1	434	609	5.6e-8	PFAM
Pfam:tRNA-synt_1g	589	682	1.2e-6	PFAM
Pfam:tRNA-synt_1	633	678	1.6e-7	PFAM
Pfam:Anticodon_1	724	867	9.2e-13	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000217116
AA Change: G229*

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	T	A	1: 89,887,674	N761K	probably damaging	Het
Amotl1	G	A	9: 14,644,922	A36V	probably benign	Het
Apol7a	A	G	15: 77,389,620	V214A	possibly damaging	Het
Arhgef25	G	T	10: 127,189,763	Q3K	unknown	Het
Bpifc	A	T	10: 85,962,027	I456N	probably damaging	Het
Cers6	C	T	2: 68,861,739	A35V	possibly damaging	Het
Corin	T	A	5: 72,304,931	Y986F	probably benign	Het
Csmd3	A	T	15: 48,673,441	Y122N	probably damaging	Het
Ddit4l	T	A	3: 137,624,235	L18*	probably null	Het
Epb41l3	T	C	17: 69,266,434		probably null	Het
Fam110a	C	T	2: 151,970,418	R144H	probably damaging	Het
Greb1l	G	T	18: 10,529,687	V890L	possibly damaging	Het
Hivep3	A	T	4: 120,099,442	M1652L	probably benign	Het
Ighv1-19	G	T	12: 114,708,926	Q25K	possibly damaging	Het
Kcnq5	G	A	1: 21,479,424	R360C	probably damaging	Het
Krr1	A	G	10: 111,977,199	R160G	probably damaging	Het
Lama3	A	G	18: 12,528,347	D515G	probably damaging	Het
Lgalsl	T	A	11: 20,831,009	M1L	possibly damaging	Het
Lrtm2	T	A	6: 119,317,298	T291S	probably benign	Het
Morc2b	G	A	17: 33,138,240	T186I	probably benign	Het
Mup20	G	T	4: 62,051,531	S157R	probably damaging	Het
Nlgn1	A	G	3: 25,435,976	V529A	probably benign	Het
Nps	T	A	7: 135,268,814	W22R	probably benign	Het
Nradd	C	A	9: 110,621,468	V214L	probably damaging	Het
Ogfrl1	G	A	1: 23,375,743	Q228*	probably null	Het
Olfr1029	G	A	2: 85,976,014	C257Y	possibly damaging	Het
Olfr681	T	A	7: 105,121,703	I82N	probably damaging	Het
Olfr979	T	C	9: 40,000,364	T288A	probably benign	Het
Ripor2	A	G	13: 24,710,193	T735A	possibly damaging	Het
Rnase6	C	A	14: 51,130,453	P101T	probably benign	Het
Slc34a2	A	T	5: 53,068,374	Y455F	possibly damaging	Het
Ssfa2	T	C	2: 79,651,443	L489P	probably damaging	Het
Stxbp1	T	C	2: 32,806,762	M330V	possibly damaging	Het
Sypl2	T	C	3: 108,217,734	T104A	possibly damaging	Het
Tenm4	G	A	7: 96,772,106		probably null	Het
Tnfrsf11a	C	A	1: 105,817,687	T150K	probably damaging	Het
Tpsg1	T	C	17: 25,374,256	L311P	possibly damaging	Het
Ttc7b	T	C	12: 100,325,558	S766G	probably benign	Het
Vmn2r83	A	G	10: 79,480,203	T478A	probably benign	Het
Wdr1	G	A	5: 38,527,849	T593I	possibly damaging	Het
Zfp407	A	G	18: 84,552,868		probably null	Het
Zfp872	G	A	9: 22,200,244	G340R	probably damaging	Het

Other mutations in Lars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01743:Lars2	APN	9	123453248	missense	probably damaging	0.98
IGL01993:Lars2	APN	9	123394943	splice site	probably benign
IGL02155:Lars2	APN	9	123454982	missense	probably damaging	0.99
IGL02941:Lars2	APN	9	123459585	missense	probably damaging	0.97
IGL03090:Lars2	APN	9	123455960	missense	probably damaging	1.00
IGL03271:Lars2	APN	9	123459484	splice site	probably null
IGL03386:Lars2	APN	9	123453390	nonsense	probably null
IGL03410:Lars2	APN	9	123418776	missense	possibly damaging	0.87
ulrich	UTSW	9	123418693	missense	probably damaging	0.99
K3955:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
P0038:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
R0276:Lars2	UTSW	9	123438121	splice site	probably benign
R1671:Lars2	UTSW	9	123418279	missense	probably benign	0.02
R1829:Lars2	UTSW	9	123431917	missense	probably benign	0.00
R2219:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R2220:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R4610:Lars2	UTSW	9	123418693	missense	probably damaging	0.99
R5027:Lars2	UTSW	9	123441495	missense	probably benign	0.38
R5195:Lars2	UTSW	9	123453310	missense	probably damaging	0.97
R5597:Lars2	UTSW	9	123454982	missense	probably damaging	0.99
R5756:Lars2	UTSW	9	123438199	missense	probably damaging	1.00
R5783:Lars2	UTSW	9	123461596	missense	probably benign
R6045:Lars2	UTSW	9	123371988	missense	probably damaging	1.00
R6235:Lars2	UTSW	9	123411880	missense	probably damaging	1.00
R6323:Lars2	UTSW	9	123441594	nonsense	probably null
R6377:Lars2	UTSW	9	123454760	missense	probably benign	0.00
R6395:Lars2	UTSW	9	123371925	missense	probably benign	0.06
R7094:Lars2	UTSW	9	123459585	missense	probably damaging	0.99
R7144:Lars2	UTSW	9	123431993	missense	probably damaging	1.00
R7233:Lars2	UTSW	9	123411954	nonsense	probably null
R7254:Lars2	UTSW	9	123454963	missense	possibly damaging	0.93
R7350:Lars2	UTSW	9	123427480	missense	probably damaging	1.00
R7413:Lars2	UTSW	9	123459503	missense	probably benign	0.30
R7614:Lars2	UTSW	9	123395111	missense
R7683:Lars2	UTSW	9	123377830	critical splice donor site	probably null
R8000:Lars2	UTSW	9	123436244	missense	probably damaging	1.00
R8061:Lars2	UTSW	9	123459497	missense	probably benign
R8355:Lars2	UTSW	9	123454715	missense	probably damaging	1.00
R8818:Lars2	UTSW	9	123392827	missense	possibly damaging	0.94
R9007:Lars2	UTSW	9	123431915	nonsense	probably null
R9351:Lars2	UTSW	9	123436301	missense	probably benign	0.38
Z1177:Lars2	UTSW	9	123454782	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGATGCCCTCAGTCTTGGAG -3'
(R):5'- TAAAACTTCAGGACCCTTGCCC -3'

Sequencing Primer
(F):5'- GTCTTGGAGCCACACTGTAAC -3'
(R):5'- TGAACAACACTGAGGCTCTCTG -3'

Posted On

2020-09-02