Incidental Mutation 'R0034:Slc22a26'
ID64611
Institutional Source Beutler Lab
Gene Symbol Slc22a26
Ensembl Gene ENSMUSG00000053303
Gene Namesolute carrier family 22 (organic cation transporter), member 26
SynonymsBC014805
MMRRC Submission 038328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0034 (G1)
Quality Score123
Status Validated
Chromosome19
Chromosomal Location7781041-7802667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7802253 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 66 (I66T)
Ref Sequence ENSEMBL: ENSMUSP00000113607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065634] [ENSMUST00000120522]
Predicted Effect probably benign
Transcript: ENSMUST00000065634
AA Change: I66T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064809
Gene: ENSMUSG00000053303
AA Change: I66T

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 96 528 1.1e-23 PFAM
Pfam:MFS_1 124 370 7.8e-17 PFAM
Pfam:MFS_1 350 547 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120522
AA Change: I66T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113607
Gene: ENSMUSG00000053303
AA Change: I66T

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 94 527 4.9e-23 PFAM
Pfam:MFS_1 124 358 1.2e-15 PFAM
Pfam:MFS_1 349 547 2.4e-12 PFAM
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C A 19: 7,420,359 H90Q probably damaging Het
4930402H24Rik T C 2: 130,736,572 H664R probably damaging Het
9430038I01Rik C T 7: 137,387,592 R60Q probably benign Het
Angpt4 C T 2: 151,929,391 T209I probably benign Het
Ap3b1 T C 13: 94,479,885 probably benign Het
Aplp1 A C 7: 30,444,442 V56G probably damaging Het
Asns G A 6: 7,676,299 P419L probably damaging Het
Atxn7 A T 14: 14,100,846 H844L probably damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cd300lb C T 11: 114,928,399 V135I probably damaging Het
Cep152 C T 2: 125,583,893 A851T probably benign Het
Cfap74 C T 4: 155,460,887 probably benign Het
Col28a1 T A 6: 8,175,708 I47L probably benign Het
Eef1d T C 15: 75,902,959 T200A probably benign Het
Faap100 A T 11: 120,372,147 M795K probably benign Het
Gabpb1 C T 2: 126,658,534 R15Q possibly damaging Het
Gata4 C A 14: 63,201,484 M381I probably benign Het
Gm5114 A G 7: 39,408,858 S446P possibly damaging Het
Gm7271 A G 5: 76,516,530 I155M probably damaging Het
Gnb1 T A 4: 155,551,689 N155K probably benign Het
Haspin G A 11: 73,138,218 T15M probably damaging Het
Heatr5a A G 12: 51,925,172 L745P probably damaging Het
Kcng3 T A 17: 83,588,383 probably benign Het
Kif15 A T 9: 122,999,285 N887I possibly damaging Het
Kif26a T C 12: 112,168,963 probably benign Het
Kif9 G A 9: 110,519,611 C738Y probably benign Het
Kifc2 G T 15: 76,667,100 C613F probably benign Het
Klf12 A G 14: 99,987,429 probably null Het
Lrp1 A T 10: 127,545,651 I3826N probably benign Het
Map2k4 A G 11: 65,719,611 probably benign Het
Myo7b A G 18: 31,960,860 S2006P probably damaging Het
Olfr631 T C 7: 103,929,501 V226A probably benign Het
Pax4 T C 6: 28,442,449 T285A probably benign Het
Pcdhb5 A G 18: 37,322,084 N506D probably damaging Het
Pkhd1l1 G A 15: 44,504,009 G768S probably benign Het
Plb1 G T 5: 32,273,113 G138V probably benign Het
Poln A C 5: 34,115,418 V398G possibly damaging Het
Poteg A G 8: 27,462,077 probably benign Het
Rapgef1 C A 2: 29,724,768 probably benign Het
Rbm43 A T 2: 51,925,710 D166E probably benign Het
Rhobtb2 T C 14: 69,788,688 T602A probably benign Het
Samd3 G A 10: 26,271,500 probably benign Het
Sbno2 A C 10: 80,058,340 probably benign Het
Sec1 A G 7: 45,679,335 V96A probably benign Het
Senp7 A C 16: 56,153,570 S385R possibly damaging Het
Sgk3 T C 1: 9,885,677 V301A probably damaging Het
Sgpl1 A T 10: 61,102,613 M467K probably damaging Het
Stra6 G A 9: 58,151,469 probably null Het
Tfrc T A 16: 32,615,396 probably null Het
Tmem30b T C 12: 73,546,005 Y112C probably damaging Het
Trap1 A T 16: 4,069,030 probably benign Het
Trpc1 A G 9: 95,749,761 S43P probably damaging Het
Tsku T C 7: 98,352,663 T154A possibly damaging Het
Uroc1 T C 6: 90,345,310 V272A probably damaging Het
Vmn1r69 T A 7: 10,580,811 probably benign Het
Vmn2r1 T A 3: 64,090,014 W364R probably damaging Het
Wnk2 G T 13: 49,068,080 T377K possibly damaging Het
Zscan20 T C 4: 128,585,662 N1012S probably damaging Het
Other mutations in Slc22a26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a26 APN 19 7782836 missense probably damaging 0.99
IGL00338:Slc22a26 APN 19 7782975 missense probably benign 0.25
IGL00736:Slc22a26 APN 19 7790162 missense possibly damaging 0.50
IGL01085:Slc22a26 APN 19 7790099 missense probably benign 0.02
IGL01581:Slc22a26 APN 19 7802184 missense probably benign 0.15
IGL02502:Slc22a26 APN 19 7790760 critical splice donor site probably null
IGL02658:Slc22a26 APN 19 7788248 missense probably benign 0.25
IGL02936:Slc22a26 APN 19 7791105 missense probably damaging 0.99
IGL03162:Slc22a26 APN 19 7802101 missense probably benign 0.00
R0633:Slc22a26 UTSW 19 7788210 critical splice donor site probably null
R0676:Slc22a26 UTSW 19 7796144 splice site probably benign
R2156:Slc22a26 UTSW 19 7802115 missense probably damaging 1.00
R4043:Slc22a26 UTSW 19 7788329 critical splice acceptor site probably null
R4781:Slc22a26 UTSW 19 7790135 missense probably benign 0.34
R4896:Slc22a26 UTSW 19 7791054 missense probably benign 0.14
R4999:Slc22a26 UTSW 19 7802181 missense probably damaging 1.00
R5125:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R5178:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R6161:Slc22a26 UTSW 19 7786447 missense possibly damaging 0.50
R6494:Slc22a26 UTSW 19 7802286 missense probably damaging 1.00
R6512:Slc22a26 UTSW 19 7802500 start gained probably benign
R6724:Slc22a26 UTSW 19 7802361 missense probably benign 0.14
R7323:Slc22a26 UTSW 19 7790894 missense probably damaging 0.97
R7375:Slc22a26 UTSW 19 7783144 splice site probably null
R7558:Slc22a26 UTSW 19 7785286 missense possibly damaging 0.94
R7634:Slc22a26 UTSW 19 7802587 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGTGGAGAGAAAAGTCCTCTGGTC -3'
(R):5'- GGGTGGTTCACAAAGGTTCTCAGC -3'

Sequencing Primer
(F):5'- GAGAGAAAAGTCCTCTGGTCATACAC -3'
(R):5'- AAGATAGTGGTCCCTCCCTAGTG -3'
Posted On2013-08-06