Incidental Mutation 'R8364:Ighv1-19'
ID646110
Institutional Source Beutler Lab
Gene Symbol Ighv1-19
Ensembl Gene ENSMUSG00000096410
Gene Nameimmunoglobulin heavy variable V1-19
SynonymsGm16855
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R8364 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location114708648-114709135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114708926 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 25 (Q25K)
Ref Sequence ENSEMBL: ENSMUSP00000141737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103505] [ENSMUST00000193855]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103505
AA Change: Q24K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100286
Gene: ENSMUSG00000096410
AA Change: Q24K

DomainStartEndE-ValueType
IGv 35 116 8.41e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193855
AA Change: Q25K

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141737
Gene: ENSMUSG00000096410
AA Change: Q25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 3.5e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T A 1: 89,887,674 N761K probably damaging Het
Amotl1 G A 9: 14,644,922 A36V probably benign Het
Apol7a A G 15: 77,389,620 V214A possibly damaging Het
Arhgef25 G T 10: 127,189,763 Q3K unknown Het
Bpifc A T 10: 85,962,027 I456N probably damaging Het
Cers6 C T 2: 68,861,739 A35V possibly damaging Het
Corin T A 5: 72,304,931 Y986F probably benign Het
Csmd3 A T 15: 48,673,441 Y122N probably damaging Het
Ddit4l T A 3: 137,624,235 L18* probably null Het
Epb41l3 T C 17: 69,266,434 probably null Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Greb1l G T 18: 10,529,687 V890L possibly damaging Het
Hivep3 A T 4: 120,099,442 M1652L probably benign Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Krr1 A G 10: 111,977,199 R160G probably damaging Het
Lama3 A G 18: 12,528,347 D515G probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lgalsl T A 11: 20,831,009 M1L possibly damaging Het
Lrtm2 T A 6: 119,317,298 T291S probably benign Het
Morc2b G A 17: 33,138,240 T186I probably benign Het
Mup20 G T 4: 62,051,531 S157R probably damaging Het
Nlgn1 A G 3: 25,435,976 V529A probably benign Het
Nps T A 7: 135,268,814 W22R probably benign Het
Nradd C A 9: 110,621,468 V214L probably damaging Het
Ogfrl1 G A 1: 23,375,743 Q228* probably null Het
Olfr1029 G A 2: 85,976,014 C257Y possibly damaging Het
Olfr681 T A 7: 105,121,703 I82N probably damaging Het
Olfr979 T C 9: 40,000,364 T288A probably benign Het
Ripor2 A G 13: 24,710,193 T735A possibly damaging Het
Rnase6 C A 14: 51,130,453 P101T probably benign Het
Slc34a2 A T 5: 53,068,374 Y455F possibly damaging Het
Ssfa2 T C 2: 79,651,443 L489P probably damaging Het
Stxbp1 T C 2: 32,806,762 M330V possibly damaging Het
Sypl2 T C 3: 108,217,734 T104A possibly damaging Het
Tenm4 G A 7: 96,772,106 probably null Het
Tnfrsf11a C A 1: 105,817,687 T150K probably damaging Het
Tpsg1 T C 17: 25,374,256 L311P possibly damaging Het
Ttc7b T C 12: 100,325,558 S766G probably benign Het
Vmn2r83 A G 10: 79,480,203 T478A probably benign Het
Wdr1 G A 5: 38,527,849 T593I possibly damaging Het
Zfp407 A G 18: 84,552,868 probably null Het
Zfp872 G A 9: 22,200,244 G340R probably damaging Het
Other mutations in Ighv1-19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ighv1-19 APN 12 114708709 missense probably benign 0.15
IGL00966:Ighv1-19 APN 12 114708949 missense possibly damaging 0.51
IGL02545:Ighv1-19 APN 12 114708739 missense probably damaging 1.00
R3729:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R3730:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R3731:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R4093:Ighv1-19 UTSW 12 114708730 missense probably damaging 1.00
R4969:Ighv1-19 UTSW 12 114708757 missense probably benign 0.12
R5021:Ighv1-19 UTSW 12 114709066 missense probably benign 0.00
R6448:Ighv1-19 UTSW 12 114708676 missense probably damaging 1.00
R7335:Ighv1-19 UTSW 12 114708951 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGTCAACAGTCAATGTGGC -3'
(R):5'- AATGTCCTCTCCACAGACACTG -3'

Sequencing Primer
(F):5'- AACAGTCAATGTGGCCTTGC -3'
(R):5'- TGAACACACTGACTCTAACCATGGG -3'
Posted On2020-09-02