Incidental Mutation 'R8364:Ripor2'
ID646111
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R8364 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24710193 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 735 (T735A)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
Predicted Effect probably benign
Transcript: ENSMUST00000038477
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091694
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110383
AA Change: T710A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: T710A

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110384
AA Change: T735A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: T735A

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T A 1: 89,887,674 N761K probably damaging Het
Amotl1 G A 9: 14,644,922 A36V probably benign Het
Apol7a A G 15: 77,389,620 V214A possibly damaging Het
Arhgef25 G T 10: 127,189,763 Q3K unknown Het
Bpifc A T 10: 85,962,027 I456N probably damaging Het
Cers6 C T 2: 68,861,739 A35V possibly damaging Het
Corin T A 5: 72,304,931 Y986F probably benign Het
Csmd3 A T 15: 48,673,441 Y122N probably damaging Het
Ddit4l T A 3: 137,624,235 L18* probably null Het
Epb41l3 T C 17: 69,266,434 probably null Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Greb1l G T 18: 10,529,687 V890L possibly damaging Het
Hivep3 A T 4: 120,099,442 M1652L probably benign Het
Ighv1-19 G T 12: 114,708,926 Q25K possibly damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Krr1 A G 10: 111,977,199 R160G probably damaging Het
Lama3 A G 18: 12,528,347 D515G probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lgalsl T A 11: 20,831,009 M1L possibly damaging Het
Lrtm2 T A 6: 119,317,298 T291S probably benign Het
Morc2b G A 17: 33,138,240 T186I probably benign Het
Mup20 G T 4: 62,051,531 S157R probably damaging Het
Nlgn1 A G 3: 25,435,976 V529A probably benign Het
Nps T A 7: 135,268,814 W22R probably benign Het
Nradd C A 9: 110,621,468 V214L probably damaging Het
Ogfrl1 G A 1: 23,375,743 Q228* probably null Het
Olfr1029 G A 2: 85,976,014 C257Y possibly damaging Het
Olfr681 T A 7: 105,121,703 I82N probably damaging Het
Olfr979 T C 9: 40,000,364 T288A probably benign Het
Rnase6 C A 14: 51,130,453 P101T probably benign Het
Slc34a2 A T 5: 53,068,374 Y455F possibly damaging Het
Ssfa2 T C 2: 79,651,443 L489P probably damaging Het
Stxbp1 T C 2: 32,806,762 M330V possibly damaging Het
Sypl2 T C 3: 108,217,734 T104A possibly damaging Het
Tenm4 G A 7: 96,772,106 probably null Het
Tnfrsf11a C A 1: 105,817,687 T150K probably damaging Het
Tpsg1 T C 17: 25,374,256 L311P possibly damaging Het
Ttc7b T C 12: 100,325,558 S766G probably benign Het
Vmn2r83 A G 10: 79,480,203 T478A probably benign Het
Wdr1 G A 5: 38,527,849 T593I possibly damaging Het
Zfp407 A G 18: 84,552,868 probably null Het
Zfp872 G A 9: 22,200,244 G340R probably damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24713700 missense probably benign 0.01
R8157:Ripor2 UTSW 13 24695617 missense probably benign 0.05
R8447:Ripor2 UTSW 13 24723788 missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24665468 intron probably benign
R8751:Ripor2 UTSW 13 24701067 missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24717668 missense not run
Predicted Primers PCR Primer
(F):5'- TTGGCAACCGAGCTGAAATAAG -3'
(R):5'- TTGGCAAAGCTAAGACACACG -3'

Sequencing Primer
(F):5'- AAAGGTACCCCTGCTTTTGAGAG -3'
(R):5'- GGCAAAGCTAAGACACACGCTATG -3'
Posted On2020-09-02