Incidental Mutation 'R8365:Kctd18'
ID646121
Institutional Source Beutler Lab
Gene Symbol Kctd18
Ensembl Gene ENSMUSG00000054770
Gene Namepotassium channel tetramerisation domain containing 18
Synonyms4932411A20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location57955101-58018956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57959152 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 263 (I263N)
Ref Sequence ENSEMBL: ENSMUSP00000110052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114410] [ENSMUST00000159826] [ENSMUST00000161608] [ENSMUST00000163061] [ENSMUST00000164963]
Predicted Effect probably damaging
Transcript: ENSMUST00000114410
AA Change: I263N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110052
Gene: ENSMUSG00000054770
AA Change: I263N

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159826
AA Change: I96N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125245
Gene: ENSMUSG00000054770
AA Change: I96N

DomainStartEndE-ValueType
SCOP:d1t1da_ 23 65 2e-11 SMART
Blast:BTB 23 107 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161608
SMART Domains Protein: ENSMUSP00000125153
Gene: ENSMUSG00000054770

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163061
SMART Domains Protein: ENSMUSP00000124053
Gene: ENSMUSG00000054770

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164963
AA Change: I96N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130952
Gene: ENSMUSG00000054770
AA Change: I96N

DomainStartEndE-ValueType
SCOP:d1t1da_ 23 65 2e-11 SMART
Blast:BTB 23 107 7e-24 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Kctd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Kctd18 APN 1 57956738 missense probably damaging 1.00
IGL01153:Kctd18 APN 1 57965391 missense probably damaging 1.00
IGL02513:Kctd18 APN 1 57965400 missense probably damaging 1.00
P0043:Kctd18 UTSW 1 57967563 missense probably damaging 1.00
R1823:Kctd18 UTSW 1 57956365 missense probably benign 0.05
R1918:Kctd18 UTSW 1 57959220 missense probably damaging 1.00
R1969:Kctd18 UTSW 1 57967620 missense probably benign 0.03
R1971:Kctd18 UTSW 1 57967620 missense probably benign 0.03
R2247:Kctd18 UTSW 1 57967642 missense possibly damaging 0.58
R4849:Kctd18 UTSW 1 57961993 missense probably damaging 0.99
R4922:Kctd18 UTSW 1 57965548 intron probably benign
R5165:Kctd18 UTSW 1 57959236 missense probably damaging 1.00
R5377:Kctd18 UTSW 1 57963093 missense probably benign 0.43
R5747:Kctd18 UTSW 1 57962024 intron probably benign
R5782:Kctd18 UTSW 1 57959237 missense probably damaging 1.00
R7132:Kctd18 UTSW 1 57967578 nonsense probably null
R7253:Kctd18 UTSW 1 57961956 nonsense probably null
R7272:Kctd18 UTSW 1 57956551 missense probably damaging 0.97
R7880:Kctd18 UTSW 1 57967619 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTCACATCCCGGAAGATCACAG -3'
(R):5'- CTGGTTCTGTTGTGCACACC -3'

Sequencing Primer
(F):5'- CGGAAGATCACAGCACCC -3'
(R):5'- TCACCTGAGAGGAGCAAGCTAC -3'
Posted On2020-09-02