Incidental Mutation 'R8365:Rorc'
ID646127
Institutional Source Beutler Lab
Gene Symbol Rorc
Ensembl Gene ENSMUSG00000028150
Gene NameRAR-related orphan receptor gamma
SynonymsThor, thymus orphan receptor, RORgamma
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94372794-94398276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94375059 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 22 (H22R)
Ref Sequence ENSEMBL: ENSMUSP00000029795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029795] [ENSMUST00000197040] [ENSMUST00000200009]
Predicted Effect probably benign
Transcript: ENSMUST00000029795
AA Change: H22R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150
AA Change: H22R

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197040
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200009
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Rorc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94388787 missense probably damaging 1.00
beto UTSW 3 94377608 splice site probably null
cashew UTSW 3 94391153 missense probably damaging 1.00
chestnut UTSW 3 94377609 splice site probably benign
macadamias UTSW 3 94397302 nonsense probably null
macadamias2 UTSW 3 94387193 missense probably damaging 1.00
R0014:Rorc UTSW 3 94377613 splice site probably benign
R0115:Rorc UTSW 3 94377609 splice site probably benign
R0365:Rorc UTSW 3 94388762 missense probably damaging 1.00
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1914:Rorc UTSW 3 94391173 missense probably damaging 1.00
R1915:Rorc UTSW 3 94391173 missense probably damaging 1.00
R2142:Rorc UTSW 3 94389526 missense probably benign 0.04
R2510:Rorc UTSW 3 94389120 missense probably benign 0.30
R4135:Rorc UTSW 3 94389519 missense probably damaging 1.00
R4181:Rorc UTSW 3 94387193 missense probably damaging 1.00
R4574:Rorc UTSW 3 94388984 missense probably benign 0.00
R4701:Rorc UTSW 3 94391710 missense probably null 1.00
R5014:Rorc UTSW 3 94391153 missense probably damaging 1.00
R5233:Rorc UTSW 3 94397325 missense probably benign 0.26
R6758:Rorc UTSW 3 94387518 missense possibly damaging 0.90
R7069:Rorc UTSW 3 94372907 nonsense probably null
R7162:Rorc UTSW 3 94377608 splice site probably null
R7169:Rorc UTSW 3 94389180 missense probably benign 0.00
R7730:Rorc UTSW 3 94393114 missense probably benign 0.43
R7922:Rorc UTSW 3 94391188 missense probably damaging 0.98
X0063:Rorc UTSW 3 94391751 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGCTGGCTGAGTAAACCC -3'
(R):5'- TGTAACTTGGCACCCCTTGG -3'

Sequencing Primer
(F):5'- AGCTGGGCACTTTCAGGAC -3'
(R):5'- TTTGGTCCTGGCCTATAAGC -3'
Posted On2020-09-02