Incidental Mutation 'R8365:Vtcn1'
ID646128
Institutional Source Beutler Lab
Gene Symbol Vtcn1
Ensembl Gene ENSMUSG00000051076
Gene NameV-set domain containing T cell activation inhibitor 1
SynonymsB7x, B7-H4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location100825459-100896922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100883829 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 61 (D61G)
Ref Sequence ENSEMBL: ENSMUSP00000057721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054791]
Predicted Effect probably benign
Transcript: ENSMUST00000054791
AA Change: D61G

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057721
Gene: ENSMUSG00000051076
AA Change: D61G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
IG 41 146 3.13e-5 SMART
Blast:IG_like 153 243 5e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for this mutation display stronger Th1 responses upon parasitic infection by L. major including reduced footpad swelling and lower parasite burden compared to controls. Responses to other Th1-driven immune responses are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Vtcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Vtcn1 APN 3 100888347 missense probably damaging 1.00
IGL02376:Vtcn1 APN 3 100892665 missense probably benign 0.05
IGL02833:Vtcn1 APN 3 100888385 missense probably damaging 1.00
IGL02876:Vtcn1 APN 3 100883829 missense probably damaging 0.97
IGL03018:Vtcn1 APN 3 100883910 missense probably damaging 0.98
R2431:Vtcn1 UTSW 3 100825577 missense possibly damaging 0.53
R4194:Vtcn1 UTSW 3 100888209 missense probably damaging 0.97
R4881:Vtcn1 UTSW 3 100892593 missense probably benign
R6916:Vtcn1 UTSW 3 100888163 critical splice acceptor site probably null
R7147:Vtcn1 UTSW 3 100883894 missense probably damaging 0.99
R7739:Vtcn1 UTSW 3 100883895 missense probably damaging 1.00
R8395:Vtcn1 UTSW 3 100883754 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCTCTGTCCGGCATGTAC -3'
(R):5'- AAGGTTTGCATTCCCTTTGC -3'

Sequencing Primer
(F):5'- CTCTGTCCGGCATGTACTAATGAAG -3'
(R):5'- TAACATGTGTAGGTGCCAGCATCC -3'
Posted On2020-09-02