Incidental Mutation 'R8365:Cym'
ID646129
Institutional Source Beutler Lab
Gene Symbol Cym
Ensembl Gene ENSMUSG00000046213
Gene Namechymosin
SynonymsLOC229697, Gm131
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107211293-107221732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107212866 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 306 (I306L)
Ref Sequence ENSEMBL: ENSMUSP00000029504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029504]
Predicted Effect probably benign
Transcript: ENSMUST00000029504
AA Change: I306L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029504
Gene: ENSMUSG00000046213
AA Change: I306L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 19 45 1.5e-16 PFAM
Pfam:Asp 73 378 5.8e-110 PFAM
Pfam:TAXi_N 74 228 3.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Cym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Cym APN 3 107214285 missense probably damaging 0.97
IGL02480:Cym APN 3 107213522 missense probably benign 0.00
IGL03224:Cym APN 3 107218732 missense possibly damaging 0.69
R1466:Cym UTSW 3 107213458 missense probably damaging 1.00
R1466:Cym UTSW 3 107213458 missense probably damaging 1.00
R1753:Cym UTSW 3 107213425 missense possibly damaging 0.91
R1768:Cym UTSW 3 107213500 missense probably damaging 1.00
R1851:Cym UTSW 3 107218714 missense probably benign 0.20
R4093:Cym UTSW 3 107214266 missense probably benign 0.06
R4094:Cym UTSW 3 107214266 missense probably benign 0.06
R4114:Cym UTSW 3 107219749 missense probably damaging 1.00
R4583:Cym UTSW 3 107211402 missense probably damaging 1.00
R4782:Cym UTSW 3 107216097 missense possibly damaging 0.60
R5844:Cym UTSW 3 107219764 missense probably benign 0.02
R5953:Cym UTSW 3 107213467 missense probably damaging 1.00
R7133:Cym UTSW 3 107214214 missense probably damaging 1.00
R7298:Cym UTSW 3 107219693 missense probably benign 0.07
R7563:Cym UTSW 3 107214232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCCACACAAAGAAGGTC -3'
(R):5'- TGTGTTGCTGAAAGCTGATACC -3'

Sequencing Primer
(F):5'- CATCCAAGAGGCCTGGTATTC -3'
(R):5'- GTTGCTGAAAGCTGATACCTCCAG -3'
Posted On2020-09-02