Incidental Mutation 'R8365:Srsf12'
ID646130
Institutional Source Beutler Lab
Gene Symbol Srsf12
Ensembl Gene ENSMUSG00000054679
Gene Nameserine/arginine-rich splicing factor 12
SynonymsSfrs13b, Srrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location33208991-33233340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 33226070 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 111 (P111R)
Ref Sequence ENSEMBL: ENSMUSP00000067939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067864] [ENSMUST00000108159]
Predicted Effect probably damaging
Transcript: ENSMUST00000067864
AA Change: P111R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067939
Gene: ENSMUSG00000054679
AA Change: P111R

DomainStartEndE-ValueType
low complexity region 31 75 N/A INTRINSIC
low complexity region 79 96 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 145 166 N/A INTRINSIC
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 204 216 9.52e-5 PROSPERO
internal_repeat_1 232 244 9.52e-5 PROSPERO
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108159
AA Change: P106R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103794
Gene: ENSMUSG00000054679
AA Change: P106R

DomainStartEndE-ValueType
RRM 11 84 9.99e-24 SMART
low complexity region 105 136 N/A INTRINSIC
low complexity region 140 161 N/A INTRINSIC
low complexity region 167 191 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Srsf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Srsf12 APN 4 33226103 missense possibly damaging 0.66
IGL02245:Srsf12 APN 4 33209103 unclassified probably benign
IGL03197:Srsf12 APN 4 33231040 missense probably damaging 1.00
IGL03412:Srsf12 APN 4 33230929 missense probably damaging 0.99
R0173:Srsf12 UTSW 4 33226117 missense probably damaging 1.00
R0704:Srsf12 UTSW 4 33231069 missense probably damaging 0.99
R1618:Srsf12 UTSW 4 33230974 missense probably damaging 0.99
R2130:Srsf12 UTSW 4 33225764 critical splice acceptor site probably benign
R2916:Srsf12 UTSW 4 33231042 nonsense probably null
R2989:Srsf12 UTSW 4 33223599 missense probably damaging 1.00
R4350:Srsf12 UTSW 4 33223612 missense possibly damaging 0.80
R4946:Srsf12 UTSW 4 33231174 missense probably damaging 0.98
R5358:Srsf12 UTSW 4 33209330 missense probably damaging 0.99
R5802:Srsf12 UTSW 4 33230929 missense probably damaging 0.99
R6577:Srsf12 UTSW 4 33209196 unclassified probably benign
R7055:Srsf12 UTSW 4 33226157 missense probably damaging 1.00
R7392:Srsf12 UTSW 4 33209265 missense unknown
R8366:Srsf12 UTSW 4 33226070 missense probably damaging 0.99
R8388:Srsf12 UTSW 4 33226070 missense probably damaging 0.99
R8389:Srsf12 UTSW 4 33226070 missense probably damaging 0.99
R8391:Srsf12 UTSW 4 33226070 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGATCGCAAAAGTAAGTGCAC -3'
(R):5'- ATCAGCCAAGTACCTGCTCC -3'

Sequencing Primer
(F):5'- GTGCACATGACCATTAGAGCTTGC -3'
(R):5'- GCCAAGTACCTGCTCCTCCAC -3'
Posted On2020-09-02