Incidental Mutation 'R8365:4931417E11Rik'
ID646136
Institutional Source Beutler Lab
Gene Symbol 4931417E11Rik
Ensembl Gene ENSMUSG00000056197
Gene NameRIKEN cDNA 4931417E11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location73468573-73469667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73469346 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 73 (N73K)
Ref Sequence ENSEMBL: ENSMUSP00000068770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070163]
Predicted Effect probably benign
Transcript: ENSMUST00000070163
AA Change: N73K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000068770
Gene: ENSMUSG00000056197
AA Change: N73K

DomainStartEndE-ValueType
Pfam:DUF766 3 294 3.1e-113 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in 4931417E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:4931417E11Rik APN 6 73468690 missense probably damaging 1.00
IGL01768:4931417E11Rik APN 6 73468916 missense possibly damaging 0.83
IGL02903:4931417E11Rik APN 6 73469120 missense probably damaging 1.00
R0084:4931417E11Rik UTSW 6 73468935 nonsense probably null
R0123:4931417E11Rik UTSW 6 73469419 missense possibly damaging 0.49
R0225:4931417E11Rik UTSW 6 73469419 missense possibly damaging 0.49
R1478:4931417E11Rik UTSW 6 73469056 missense probably damaging 1.00
R1640:4931417E11Rik UTSW 6 73468886 missense probably benign 0.13
R4616:4931417E11Rik UTSW 6 73469269 missense probably benign 0.02
R5451:4931417E11Rik UTSW 6 73468867 missense probably benign 0.00
R5875:4931417E11Rik UTSW 6 73469045 missense possibly damaging 0.50
R5911:4931417E11Rik UTSW 6 73468691 missense probably damaging 0.99
R6784:4931417E11Rik UTSW 6 73468935 nonsense probably null
R6982:4931417E11Rik UTSW 6 73469544 nonsense probably null
R7990:4931417E11Rik UTSW 6 73469545 missense probably damaging 1.00
R8381:4931417E11Rik UTSW 6 73468912 missense probably damaging 1.00
X0024:4931417E11Rik UTSW 6 73469050 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGACTTGGATTGTAGAGCATC -3'
(R):5'- CTGAATGGCATGCTTTGGAC -3'

Sequencing Primer
(F):5'- GTAGAGCATCGTGTACCAATCTG -3'
(R):5'- GGACTCTATTGTGGGAAGACTC -3'
Posted On2020-09-02