Incidental Mutation 'R8365:Srgap3'
ID646137
Institutional Source Beutler Lab
Gene Symbol Srgap3
Ensembl Gene ENSMUSG00000030257
Gene NameSLIT-ROBO Rho GTPase activating protein 3
SynonymsD130026O08Rik, Arhgap14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location112717971-112947266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112816734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 94 (S94P)
Ref Sequence ENSEMBL: ENSMUSP00000085712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088373] [ENSMUST00000113169]
Predicted Effect probably damaging
Transcript: ENSMUST00000088373
AA Change: S94P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085712
Gene: ENSMUSG00000030257
AA Change: S94P

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
RhoGAP 517 691 7.43e-66 SMART
SH3 747 802 9.69e-15 SMART
coiled coil region 955 985 N/A INTRINSIC
low complexity region 1025 1038 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113169
AA Change: S94P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108794
Gene: ENSMUSG00000030257
AA Change: S94P

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
Blast:RhoGAP 434 474 4e-11 BLAST
low complexity region 476 488 N/A INTRINSIC
RhoGAP 493 667 7.43e-66 SMART
SH3 723 778 9.69e-15 SMART
coiled coil region 931 961 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in spine density in the brain CA1 and cortical layers IV/V. Mice homozygous for a different knock-out allele exhibit a neurodevelopment disorder with schizophrenia-related intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Srgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Srgap3 APN 6 112739397 missense probably damaging 0.98
IGL01325:Srgap3 APN 6 112775686 missense probably damaging 1.00
IGL01608:Srgap3 APN 6 112946478 missense probably benign 0.00
IGL01626:Srgap3 APN 6 112773648 missense probably damaging 0.98
IGL01787:Srgap3 APN 6 112723022 missense probably benign 0.00
IGL02698:Srgap3 APN 6 112746928 missense probably damaging 0.98
IGL02805:Srgap3 APN 6 112727263 missense probably damaging 0.99
IGL02813:Srgap3 APN 6 112731480 missense probably damaging 1.00
IGL02876:Srgap3 APN 6 112771453 missense probably damaging 1.00
IGL03264:Srgap3 APN 6 112816675 missense probably damaging 1.00
IGL03342:Srgap3 APN 6 112775687 missense probably damaging 1.00
R0007:Srgap3 UTSW 6 112829512 missense probably damaging 1.00
R0371:Srgap3 UTSW 6 112771471 missense probably damaging 0.99
R0607:Srgap3 UTSW 6 112723119 missense probably damaging 1.00
R1628:Srgap3 UTSW 6 112739370 missense probably damaging 0.99
R1669:Srgap3 UTSW 6 112722904 missense probably benign 0.36
R1858:Srgap3 UTSW 6 112771518 missense probably damaging 1.00
R1876:Srgap3 UTSW 6 112775566 missense probably damaging 0.98
R1896:Srgap3 UTSW 6 112738997 missense probably benign 0.11
R2159:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R2221:Srgap3 UTSW 6 112946493 missense probably damaging 0.98
R2862:Srgap3 UTSW 6 112722972 missense probably damaging 0.99
R3160:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R3162:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R4092:Srgap3 UTSW 6 112723084 missense probably benign 0.00
R4561:Srgap3 UTSW 6 112781054 missense probably damaging 0.98
R4781:Srgap3 UTSW 6 112757425 intron probably benign
R4825:Srgap3 UTSW 6 112727310 missense probably benign
R4887:Srgap3 UTSW 6 112746934 missense probably damaging 1.00
R5304:Srgap3 UTSW 6 112766939 missense probably damaging 1.00
R5556:Srgap3 UTSW 6 112739078 missense probably damaging 0.99
R5672:Srgap3 UTSW 6 112775561 missense probably benign
R5879:Srgap3 UTSW 6 112722846 missense possibly damaging 0.67
R5944:Srgap3 UTSW 6 112795814 missense possibly damaging 0.89
R6277:Srgap3 UTSW 6 112739383 missense probably benign 0.02
R6298:Srgap3 UTSW 6 112816610 missense probably damaging 0.98
R6407:Srgap3 UTSW 6 112723006 missense probably damaging 0.99
R6408:Srgap3 UTSW 6 112723006 missense probably damaging 0.99
R6797:Srgap3 UTSW 6 112829542 missense probably damaging 1.00
R6852:Srgap3 UTSW 6 112816661 missense probably damaging 1.00
R6965:Srgap3 UTSW 6 112723129 missense probably damaging 1.00
R7055:Srgap3 UTSW 6 112746963 missense probably damaging 0.97
R7067:Srgap3 UTSW 6 112757305 intron probably benign
R7361:Srgap3 UTSW 6 112746921 missense probably damaging 0.99
R7479:Srgap3 UTSW 6 112735833 critical splice donor site probably null
R7606:Srgap3 UTSW 6 112739376 missense probably benign 0.00
R7731:Srgap3 UTSW 6 112766897 missense probably benign 0.36
R7787:Srgap3 UTSW 6 112775559 missense probably benign 0.02
R7934:Srgap3 UTSW 6 112731489 missense probably damaging 1.00
R8026:Srgap3 UTSW 6 112739364 missense probably benign 0.00
R8040:Srgap3 UTSW 6 112739364 missense probably benign 0.00
R8066:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R8067:Srgap3 UTSW 6 112739364 missense probably benign 0.00
R8090:Srgap3 UTSW 6 112781035 nonsense probably null
R8151:Srgap3 UTSW 6 112816667 missense probably damaging 1.00
R8248:Srgap3 UTSW 6 112723143 missense probably damaging 1.00
R8369:Srgap3 UTSW 6 112722818 missense probably benign
R8444:Srgap3 UTSW 6 112775548 missense possibly damaging 0.56
R8509:Srgap3 UTSW 6 112731336 nonsense probably null
X0062:Srgap3 UTSW 6 112795786 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGCTGGTCTGGGAAAG -3'
(R):5'- TCTTCAGAGAAAGCATAGGGC -3'

Sequencing Primer
(F):5'- GAGACCCAGGGCAGATAGG -3'
(R):5'- AGCACGCTCTATAACTGTGG -3'
Posted On2020-09-02