Incidental Mutation 'R8365:Vmn1r167'
ID646140
Institutional Source Beutler Lab
Gene Symbol Vmn1r167
Ensembl Gene ENSMUSG00000090715
Gene Namevomeronasal 1 receptor 167
SynonymsGm6279
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23503646-23507206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23504775 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 272 (I272N)
Ref Sequence ENSEMBL: ENSMUSP00000129193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164527] [ENSMUST00000227713]
Predicted Effect probably benign
Transcript: ENSMUST00000164527
AA Change: I272N

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129193
Gene: ENSMUSG00000090715
AA Change: I272N

DomainStartEndE-ValueType
Pfam:TAS2R 19 307 1.5e-13 PFAM
Pfam:7tm_1 41 299 3.8e-6 PFAM
Pfam:V1R 52 306 2.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227713
AA Change: I272N

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Vmn1r167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Vmn1r167 APN 7 23505439 missense probably damaging 0.98
IGL02261:Vmn1r167 APN 7 23504836 missense probably benign 0.17
IGL02963:Vmn1r167 APN 7 23505550 missense possibly damaging 0.60
R0054:Vmn1r167 UTSW 7 23504909 missense possibly damaging 0.89
R0555:Vmn1r167 UTSW 7 23505087 missense probably damaging 1.00
R0766:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1312:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1532:Vmn1r167 UTSW 7 23504779 missense probably benign 0.01
R1937:Vmn1r167 UTSW 7 23505027 missense probably benign 0.25
R2162:Vmn1r167 UTSW 7 23504799 missense possibly damaging 0.91
R4639:Vmn1r167 UTSW 7 23505586 missense probably benign 0.00
R4661:Vmn1r167 UTSW 7 23504692 missense probably damaging 1.00
R4845:Vmn1r167 UTSW 7 23504733 missense probably benign 0.01
R4868:Vmn1r167 UTSW 7 23504736 missense probably benign
R4993:Vmn1r167 UTSW 7 23505228 missense probably damaging 1.00
R5693:Vmn1r167 UTSW 7 23505221 nonsense probably null
R6622:Vmn1r167 UTSW 7 23505589 start codon destroyed probably null
R7800:Vmn1r167 UTSW 7 23504644 makesense probably null
R8297:Vmn1r167 UTSW 7 23504790 missense probably damaging 1.00
R8411:Vmn1r167 UTSW 7 23505556 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTGGCCAAGAAACACGTTAAG -3'
(R):5'- GTCTCCATGGTAATTCTCCTGAAC -3'

Sequencing Primer
(F):5'- ACGTTAAGTGTATTCCCAGAAAATAG -3'
(R):5'- TGGTAATTCTCCTGAACAGACAC -3'
Posted On2020-09-02