Incidental Mutation 'R8365:Brf2'
ID646144
Institutional Source Beutler Lab
Gene Symbol Brf2
Ensembl Gene ENSMUSG00000031487
Gene NameBRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms5730512K07Rik, TFIIIB50, 2700059M06Rik, BRFU
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location27123364-27128680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27128538 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 13 (S13P)
Ref Sequence ENSEMBL: ENSMUSP00000033877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033877] [ENSMUST00000209770] [ENSMUST00000210552] [ENSMUST00000211151]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033877
AA Change: S13P

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033877
Gene: ENSMUSG00000031487
AA Change: S13P

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 6 42 5.7e-11 PFAM
SCOP:d1aisb1 73 167 1e-12 SMART
Blast:CYCLIN 74 158 2e-51 BLAST
Blast:CYCLIN 171 275 6e-61 BLAST
low complexity region 322 336 N/A INTRINSIC
low complexity region 355 367 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209770
AA Change: S13P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210552
AA Change: S13P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211151
AA Change: S13P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000211236
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the multiple subunits of the RNA polymerase III transcription factor complex required for transcription of genes with promoter elements upstream of the initiation site. The product of this gene, a TFIIB-like factor, is directly recruited to the TATA-box of polymerase III small nuclear RNA gene promoters through its interaction with the TATA-binding protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Brf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03371:Brf2 APN 8 27125844 missense probably benign 0.11
R0179:Brf2 UTSW 8 27125868 missense possibly damaging 0.73
R0615:Brf2 UTSW 8 27124031 missense probably benign 0.00
R1066:Brf2 UTSW 8 27123946 missense probably benign 0.34
R1882:Brf2 UTSW 8 27128549 missense probably damaging 1.00
R3766:Brf2 UTSW 8 27124468 missense possibly damaging 0.50
R5546:Brf2 UTSW 8 27124283 missense possibly damaging 0.67
R5716:Brf2 UTSW 8 27126046 missense probably benign
R6965:Brf2 UTSW 8 27124558 missense probably benign 0.34
R7903:Brf2 UTSW 8 27126093 missense possibly damaging 0.77
R7923:Brf2 UTSW 8 27124190 nonsense probably null
R8184:Brf2 UTSW 8 27123985 missense possibly damaging 0.81
R8282:Brf2 UTSW 8 27124593 missense
X0026:Brf2 UTSW 8 27126051 missense probably benign
Z1088:Brf2 UTSW 8 27123991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTAACTGTGCGCATGGCC -3'
(R):5'- AGCAAACTGCCAGCCGATTG -3'

Sequencing Primer
(F):5'- CTGTGCGCATGGCCAAGAAAG -3'
(R):5'- GCCCAGTTACAAGTTCTC -3'
Posted On2020-09-02