Incidental Mutation 'R8365:Ucp1'
ID 646145
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Name uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms Slc25a7
MMRRC Submission 067736-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8365 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 84016981-84025081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 84020628 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 146 (H146P)
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
AlphaFold P12242
Predicted Effect probably damaging
Transcript: ENSMUST00000034146
AA Change: H146P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: H146P

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,557,918 (GRCm39) C79* probably null Het
Abcc9 A T 6: 142,544,798 (GRCm39) S1430T probably benign Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Ankrd17 T C 5: 90,398,378 (GRCm39) K1724R possibly damaging Het
Brf2 A G 8: 27,618,566 (GRCm39) S13P possibly damaging Het
Cfap46 T A 7: 139,263,000 (GRCm39) K18* probably null Het
Cym T G 3: 107,120,182 (GRCm39) I306L probably benign Het
Cyp2c66 A T 19: 39,165,048 (GRCm39) H343L probably benign Het
Cyp2d34 T C 15: 82,504,874 (GRCm39) Y62C probably damaging Het
D630045J12Rik A G 6: 38,172,570 (GRCm39) S533P probably benign Het
Dnajc10 A G 2: 80,176,902 (GRCm39) Y619C probably damaging Het
Dnal1 T A 12: 84,178,163 (GRCm39) probably null Het
Eif4g1 T A 16: 20,502,277 (GRCm39) M914K probably damaging Het
Epb41l2 C A 10: 25,317,584 (GRCm39) Q34K probably benign Het
Esyt1 T G 10: 128,352,422 (GRCm39) N730H possibly damaging Het
Fbxo15 T G 18: 84,980,739 (GRCm39) I238S probably damaging Het
Foxn3 T C 12: 99,307,727 (GRCm39) K204E probably damaging Het
Gtf2i G A 5: 134,303,434 (GRCm39) S279L probably benign Het
Hhatl A G 9: 121,618,931 (GRCm39) M67T probably damaging Het
Itpkc C A 7: 26,911,777 (GRCm39) R598L probably damaging Het
Itprid2 T C 2: 79,492,689 (GRCm39) S1079P probably damaging Het
Jkampl A T 6: 73,446,329 (GRCm39) N73K probably benign Het
Kctd18 A T 1: 57,998,311 (GRCm39) I263N probably damaging Het
Map1a T A 2: 121,138,528 (GRCm39) M3002K probably damaging Het
Med13l T A 5: 118,866,709 (GRCm39) S588T possibly damaging Het
Pcdh8 T A 14: 80,008,426 (GRCm39) I46F probably damaging Het
Prdm6 T C 18: 53,685,137 (GRCm39) V392A probably benign Het
Ptprt T A 2: 161,743,451 (GRCm39) I497F probably benign Het
Rorc A G 3: 94,282,366 (GRCm39) H22R probably benign Het
Scaf8 A G 17: 3,246,241 (GRCm39) I777V possibly damaging Het
Shroom1 A T 11: 53,356,468 (GRCm39) R444* probably null Het
Srcap C T 7: 127,148,869 (GRCm39) T2030I probably damaging Het
Srgap3 A G 6: 112,793,695 (GRCm39) S94P probably damaging Het
Srsf12 C G 4: 33,226,070 (GRCm39) P111R probably damaging Het
Ttc27 C T 17: 75,054,669 (GRCm39) T325I probably damaging Het
Vmn1r167 A T 7: 23,204,200 (GRCm39) I272N probably benign Het
Vmn2r1 T C 3: 63,994,034 (GRCm39) S127P possibly damaging Het
Vtcn1 A G 3: 100,791,145 (GRCm39) D61G probably benign Het
Zfp994 A T 17: 22,420,227 (GRCm39) C241S probably damaging Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 84,020,577 (GRCm39) missense probably damaging 1.00
R0050:Ucp1 UTSW 8 84,020,857 (GRCm39) missense probably damaging 1.00
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0505:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 84,018,232 (GRCm39) splice site probably benign
R0681:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 84,024,476 (GRCm39) splice site probably benign
R1606:Ucp1 UTSW 8 84,021,933 (GRCm39) missense probably damaging 1.00
R1722:Ucp1 UTSW 8 84,017,317 (GRCm39) missense probably benign 0.25
R1809:Ucp1 UTSW 8 84,024,496 (GRCm39) missense probably damaging 0.99
R1823:Ucp1 UTSW 8 84,020,661 (GRCm39) missense probably damaging 1.00
R3809:Ucp1 UTSW 8 84,017,270 (GRCm39) missense probably damaging 0.99
R4085:Ucp1 UTSW 8 84,020,580 (GRCm39) missense probably benign 0.43
R4673:Ucp1 UTSW 8 84,021,876 (GRCm39) missense probably damaging 1.00
R4998:Ucp1 UTSW 8 84,024,484 (GRCm39) critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 84,020,832 (GRCm39) missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 84,017,320 (GRCm39) missense probably benign 0.12
R5790:Ucp1 UTSW 8 84,024,520 (GRCm39) missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 84,020,567 (GRCm39) missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 84,020,718 (GRCm39) critical splice donor site probably null
R6732:Ucp1 UTSW 8 84,018,106 (GRCm39) missense probably benign 0.08
R7282:Ucp1 UTSW 8 84,020,531 (GRCm39) missense probably benign 0.03
R7343:Ucp1 UTSW 8 84,021,881 (GRCm39) missense probably damaging 0.99
R7878:Ucp1 UTSW 8 84,024,521 (GRCm39) missense probably benign 0.19
R8008:Ucp1 UTSW 8 84,020,640 (GRCm39) missense probably benign 0.32
R8899:Ucp1 UTSW 8 84,017,216 (GRCm39) missense probably benign 0.35
R9186:Ucp1 UTSW 8 84,017,272 (GRCm39) nonsense probably null
R9499:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9551:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9552:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTGTCCTCTGTGCACC -3'
(R):5'- TTCTCATTAGATTAGGGGTCGTCC -3'

Sequencing Primer
(F):5'- ATGTAAATGTATGTGATGCTTGGTAG -3'
(R):5'- GGTCGTCCCTGCAGAAAAAC -3'
Posted On 2020-09-02