Incidental Mutation 'R8365:Hhatl'
ID646146
Institutional Source Beutler Lab
Gene Symbol Hhatl
Ensembl Gene ENSMUSG00000032523
Gene Namehedgehog acyltransferase-like
SynonymsGup1, 1110011D13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location121784016-121792507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121789865 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 67 (M67T)
Ref Sequence ENSEMBL: ENSMUSP00000035110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035110] [ENSMUST00000163981] [ENSMUST00000214768] [ENSMUST00000215477] [ENSMUST00000215910] [ENSMUST00000217652]
Predicted Effect probably damaging
Transcript: ENSMUST00000035110
AA Change: M67T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035110
Gene: ENSMUSG00000032523
AA Change: M67T

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:MBOAT 63 448 2.7e-15 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163981
AA Change: M67T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131971
Gene: ENSMUSG00000032523
AA Change: M67T

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Pfam:MBOAT 97 444 3.7e-16 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214768
AA Change: M67T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215477
Predicted Effect probably benign
Transcript: ENSMUST00000215910
Predicted Effect probably benign
Transcript: ENSMUST00000217652
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Hhatl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Hhatl APN 9 121789791 missense probably benign 0.21
R0270:Hhatl UTSW 9 121784720 missense probably benign 0.14
R0399:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0417:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0436:Hhatl UTSW 9 121788762 missense probably benign 0.00
R1741:Hhatl UTSW 9 121789059 missense possibly damaging 0.67
R2250:Hhatl UTSW 9 121788171 missense possibly damaging 0.67
R2284:Hhatl UTSW 9 121789582 missense probably damaging 1.00
R2513:Hhatl UTSW 9 121789170 missense probably benign 0.13
R4278:Hhatl UTSW 9 121784219 missense probably benign
R4717:Hhatl UTSW 9 121789877 missense probably damaging 1.00
R4851:Hhatl UTSW 9 121789011 missense probably damaging 1.00
R5759:Hhatl UTSW 9 121788277 missense probably damaging 1.00
R6330:Hhatl UTSW 9 121788225 splice site probably null
R6387:Hhatl UTSW 9 121790401 missense probably benign 0.09
R6460:Hhatl UTSW 9 121789522 missense probably benign 0.32
R6541:Hhatl UTSW 9 121785144 missense probably damaging 1.00
R6651:Hhatl UTSW 9 121784702 missense probably damaging 1.00
R6670:Hhatl UTSW 9 121789071 missense probably damaging 0.96
R6914:Hhatl UTSW 9 121788180 missense probably benign
R6942:Hhatl UTSW 9 121788180 missense probably benign
R7026:Hhatl UTSW 9 121788273 missense probably benign 0.26
R7251:Hhatl UTSW 9 121785050 critical splice donor site probably null
R7323:Hhatl UTSW 9 121789586 missense probably benign
R7958:Hhatl UTSW 9 121784586 critical splice donor site probably null
R8425:Hhatl UTSW 9 121789102 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AACTTCTCTGTGCACATGGGAG -3'
(R):5'- GGCAGAACTTTGAGGGGTTC -3'

Sequencing Primer
(F):5'- CTGTGCACATGGGAGGGGAC -3'
(R):5'- AGGGGTTCTTTAGGACCTTCATCC -3'
Posted On2020-09-02