Incidental Mutation 'R8365:Esyt1'
ID646148
Institutional Source Beutler Lab
Gene Symbol Esyt1
Ensembl Gene ENSMUSG00000025366
Gene Nameextended synaptotagmin-like protein 1
Synonymsvp115, Mbc2, Fam62a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128509965-128525871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 128516553 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 730 (N730H)
Ref Sequence ENSEMBL: ENSMUSP00000026427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026427]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026427
AA Change: N730H

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026427
Gene: ENSMUSG00000025366
AA Change: N730H

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:SMP_LBD 125 303 4.3e-80 PFAM
C2 320 422 1.27e-17 SMART
C2 469 563 4.62e-11 SMART
C2 635 737 4.05e-25 SMART
C2 786 879 3.05e-11 SMART
low complexity region 909 921 N/A INTRINSIC
C2 975 1080 1.51e-15 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Esyt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Esyt1 APN 10 128517635 missense possibly damaging 0.94
IGL00518:Esyt1 APN 10 128521874 missense probably benign 0.00
IGL00534:Esyt1 APN 10 128515684 critical splice donor site probably null
IGL00578:Esyt1 APN 10 128511743 missense probably damaging 1.00
IGL00899:Esyt1 APN 10 128517063 missense probably damaging 1.00
IGL01308:Esyt1 APN 10 128519791 missense possibly damaging 0.62
IGL01373:Esyt1 APN 10 128518941 missense possibly damaging 0.91
IGL01476:Esyt1 APN 10 128511494 missense probably damaging 0.99
IGL01655:Esyt1 APN 10 128522312 missense possibly damaging 0.72
IGL02302:Esyt1 APN 10 128512367 missense probably damaging 1.00
IGL02441:Esyt1 APN 10 128512424 missense possibly damaging 0.89
IGL02550:Esyt1 APN 10 128522093 missense probably damaging 1.00
IGL02653:Esyt1 APN 10 128511008 missense probably benign
IGL02948:Esyt1 APN 10 128519171 missense probably damaging 0.96
IGL02986:Esyt1 APN 10 128516757 missense probably damaging 0.96
IGL03033:Esyt1 APN 10 128516383 missense probably benign 0.00
R0039:Esyt1 UTSW 10 128520962 missense probably damaging 0.99
R0285:Esyt1 UTSW 10 128512218 missense possibly damaging 0.50
R0453:Esyt1 UTSW 10 128512209 missense probably benign 0.00
R1123:Esyt1 UTSW 10 128516558 missense probably benign 0.35
R1496:Esyt1 UTSW 10 128512428 missense possibly damaging 0.63
R1569:Esyt1 UTSW 10 128518994 missense possibly damaging 0.88
R1691:Esyt1 UTSW 10 128525534 missense probably benign 0.01
R1813:Esyt1 UTSW 10 128519618 missense probably benign
R1827:Esyt1 UTSW 10 128516369 missense probably benign 0.01
R2038:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2039:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2115:Esyt1 UTSW 10 128522104 missense probably damaging 0.99
R2696:Esyt1 UTSW 10 128517045 missense probably damaging 1.00
R3919:Esyt1 UTSW 10 128521036 unclassified probably benign
R3980:Esyt1 UTSW 10 128511524 missense probably damaging 0.99
R4223:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R4225:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R5249:Esyt1 UTSW 10 128516574 missense probably benign 0.00
R5534:Esyt1 UTSW 10 128519460 missense probably benign 0.07
R5704:Esyt1 UTSW 10 128511510 missense probably damaging 1.00
R6252:Esyt1 UTSW 10 128511902 missense probably benign 0.01
R6431:Esyt1 UTSW 10 128516674 critical splice donor site probably null
R7013:Esyt1 UTSW 10 128525651 missense probably damaging 1.00
R7102:Esyt1 UTSW 10 128516236 missense probably damaging 0.98
R7152:Esyt1 UTSW 10 128515760 missense possibly damaging 0.79
R7570:Esyt1 UTSW 10 128518932 missense possibly damaging 0.52
R7700:Esyt1 UTSW 10 128515854 splice site probably benign
R7732:Esyt1 UTSW 10 128521825 critical splice donor site probably null
R8009:Esyt1 UTSW 10 128511485 missense probably benign 0.01
R8049:Esyt1 UTSW 10 128512086 missense probably benign
R8222:Esyt1 UTSW 10 128511778 missense possibly damaging 0.77
R8366:Esyt1 UTSW 10 128516553 missense possibly damaging 0.89
R8407:Esyt1 UTSW 10 128511927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTAACTCAGCAGCAGTC -3'
(R):5'- AAGGAGAGATTTCCCTTTTCTCCC -3'

Sequencing Primer
(F):5'- TAACTCAGCAGCAGTCGGTCTAG -3'
(R):5'- CCTGGCCAAGAGCTTGAGATTG -3'
Posted On2020-09-02