Incidental Mutation 'R8365:Dnal1'
ID646150
Institutional Source Beutler Lab
Gene Symbol Dnal1
Ensembl Gene ENSMUSG00000042523
Gene Namedynein, axonemal, light chain 1
SynonymsDnal1, E330027P08Rik, 1700010H15Rik, Dnalc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location84114366-84147498 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 84131389 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046340] [ENSMUST00000123491] [ENSMUST00000136159] [ENSMUST00000140812] [ENSMUST00000156138]
Predicted Effect probably null
Transcript: ENSMUST00000046340
SMART Domains Protein: ENSMUSP00000037076
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
Pfam:LRR_1 32 52 8.1e-2 PFAM
Pfam:LRR_4 54 96 3.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123491
SMART Domains Protein: ENSMUSP00000121038
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
Pfam:LRR_4 93 135 1.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136159
SMART Domains Protein: ENSMUSP00000123497
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
PDB:1DS9|A 1 98 3e-28 PDB
SCOP:d1h6ta2 11 88 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140812
SMART Domains Protein: ENSMUSP00000121131
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
PDB:1DS9|A 1 55 9e-8 PDB
SCOP:d1dcea3 1 56 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156138
SMART Domains Protein: ENSMUSP00000118584
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
PDB:1M9L|A 1 50 1e-11 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Dnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02683:Dnal1 APN 12 84138354 missense probably damaging 0.98
IGL02811:Dnal1 APN 12 84131392 splice site probably null
IGL03412:Dnal1 APN 12 84135667 start codon destroyed probably null 1.00
R2421:Dnal1 UTSW 12 84136706 nonsense probably null
R4591:Dnal1 UTSW 12 84133853 missense probably benign 0.00
R4667:Dnal1 UTSW 12 84136700 intron probably benign
R5352:Dnal1 UTSW 12 84136548 missense possibly damaging 0.93
R5922:Dnal1 UTSW 12 84126972 missense probably damaging 0.99
R7334:Dnal1 UTSW 12 84127006 missense probably damaging 1.00
R7450:Dnal1 UTSW 12 84124523 missense probably benign 0.11
R7529:Dnal1 UTSW 12 84131343 missense probably benign
R7585:Dnal1 UTSW 12 84124493 missense probably benign 0.00
R8169:Dnal1 UTSW 12 84124556 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAGTCAATTAGCCTTCAAAC -3'
(R):5'- TCCTGGTTACAAAGCACTGG -3'

Sequencing Primer
(F):5'- GAACTCAGGTCTTCAAGCTTGGC -3'
(R):5'- CACTGGGAATATAAGTGGCCC -3'
Posted On2020-09-02