Incidental Mutation 'R8365:Scaf8'
ID646155
Institutional Source Beutler Lab
Gene Symbol Scaf8
Ensembl Gene ENSMUSG00000046201
Gene NameSR-related CTD-associated factor 8
SynonymsRbm16, A630086M08Rik, A930036P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location3114972-3198859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3195966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 777 (I777V)
Ref Sequence ENSEMBL: ENSMUSP00000076024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076734]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076734
AA Change: I777V

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: I777V

DomainStartEndE-ValueType
RPR 6 136 1.26e-42 SMART
low complexity region 157 171 N/A INTRINSIC
low complexity region 193 223 N/A INTRINSIC
low complexity region 232 251 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 397 462 N/A INTRINSIC
RRM 478 547 9.2e-14 SMART
low complexity region 644 677 N/A INTRINSIC
low complexity region 685 712 N/A INTRINSIC
low complexity region 857 883 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
low complexity region 962 971 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
internal_repeat_1 1048 1064 2e-5 PROSPERO
internal_repeat_1 1059 1075 2e-5 PROSPERO
low complexity region 1146 1168 N/A INTRINSIC
low complexity region 1249 1268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Scaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Scaf8 APN 17 3171134 missense unknown
IGL00956:Scaf8 APN 17 3171147 missense unknown
IGL01610:Scaf8 APN 17 3195849 missense probably damaging 1.00
IGL01967:Scaf8 APN 17 3196938 missense possibly damaging 0.91
IGL02005:Scaf8 APN 17 3185870 missense probably damaging 1.00
IGL03037:Scaf8 APN 17 3190221 missense probably damaging 0.99
BB004:Scaf8 UTSW 17 3159220 missense unknown
BB014:Scaf8 UTSW 17 3159220 missense unknown
R0320:Scaf8 UTSW 17 3178255 missense unknown
R0789:Scaf8 UTSW 17 3196837 missense possibly damaging 0.94
R0850:Scaf8 UTSW 17 3195774 splice site probably null
R0919:Scaf8 UTSW 17 3197120 missense probably damaging 1.00
R1488:Scaf8 UTSW 17 3197597 missense probably damaging 0.97
R1544:Scaf8 UTSW 17 3145154 missense probably damaging 0.96
R1928:Scaf8 UTSW 17 3168077 missense unknown
R1972:Scaf8 UTSW 17 3169371 missense unknown
R2156:Scaf8 UTSW 17 3164132 splice site probably null
R2164:Scaf8 UTSW 17 3197210 missense probably damaging 1.00
R2680:Scaf8 UTSW 17 3197591 missense possibly damaging 0.95
R3794:Scaf8 UTSW 17 3190249 missense probably damaging 1.00
R4368:Scaf8 UTSW 17 3171195 missense unknown
R4673:Scaf8 UTSW 17 3197985 missense probably benign 0.04
R4694:Scaf8 UTSW 17 3197404 missense probably damaging 1.00
R4716:Scaf8 UTSW 17 3177123 missense unknown
R4852:Scaf8 UTSW 17 3178219 missense unknown
R5036:Scaf8 UTSW 17 3164262 unclassified probably benign
R5193:Scaf8 UTSW 17 3190165 missense probably benign 0.02
R5429:Scaf8 UTSW 17 3197110 missense probably benign 0.14
R5816:Scaf8 UTSW 17 3177713 missense unknown
R6050:Scaf8 UTSW 17 3168108 missense unknown
R6493:Scaf8 UTSW 17 3171119 missense unknown
R6616:Scaf8 UTSW 17 3168055 missense unknown
R7065:Scaf8 UTSW 17 3159211 missense probably damaging 1.00
R7112:Scaf8 UTSW 17 3163029 missense unknown
R7141:Scaf8 UTSW 17 3159182 missense unknown
R7198:Scaf8 UTSW 17 3163098 missense unknown
R7265:Scaf8 UTSW 17 3177625 missense unknown
R7592:Scaf8 UTSW 17 3171222 critical splice donor site probably null
R7711:Scaf8 UTSW 17 3187634 missense probably damaging 0.97
R7813:Scaf8 UTSW 17 3197274 missense probably damaging 1.00
R7867:Scaf8 UTSW 17 3177719 missense unknown
R7927:Scaf8 UTSW 17 3159220 missense unknown
R7937:Scaf8 UTSW 17 3197207 missense probably damaging 0.99
R7958:Scaf8 UTSW 17 3171122 missense unknown
R7960:Scaf8 UTSW 17 3171122 missense unknown
R8024:Scaf8 UTSW 17 3159293 missense unknown
R8118:Scaf8 UTSW 17 3164183 missense unknown
R8285:Scaf8 UTSW 17 3177129 missense unknown
R8303:Scaf8 UTSW 17 3148552 missense unknown
Z1088:Scaf8 UTSW 17 3162983 unclassified probably benign
Z1177:Scaf8 UTSW 17 3162994 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCATTGTCCATGACCCCTG -3'
(R):5'- AGCTGTCTCCAACCCTTATAATG -3'

Sequencing Primer
(F):5'- CCCCTGAAGCTGTGAAAGATGTTG -3'
(R):5'- GGCTCTTCTGGAAATAATATTGCAGG -3'
Posted On2020-09-02