Incidental Mutation 'R8365:Zfp994'
ID646156
Institutional Source Beutler Lab
Gene Symbol Zfp994
Ensembl Gene ENSMUSG00000096433
Gene Namezinc finger protein 994
SynonymsGm4944
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location22197265-22225614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22201246 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 241 (C241S)
Ref Sequence ENSEMBL: ENSMUSP00000136105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179996]
Predicted Effect probably damaging
Transcript: ENSMUST00000179996
AA Change: C241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136105
Gene: ENSMUSG00000096433
AA Change: C241S

DomainStartEndE-ValueType
KRAB 13 73 3.33e-20 SMART
ZnF_C2H2 183 205 8.09e-1 SMART
ZnF_C2H2 211 233 1.84e-4 SMART
ZnF_C2H2 239 261 2.99e-4 SMART
ZnF_C2H2 267 289 1.04e-3 SMART
ZnF_C2H2 295 317 2.61e-4 SMART
ZnF_C2H2 323 345 4.3e-5 SMART
ZnF_C2H2 351 373 6.78e-3 SMART
ZnF_C2H2 379 401 1.12e-3 SMART
ZnF_C2H2 407 429 5.5e-3 SMART
ZnF_C2H2 435 457 1.3e-4 SMART
ZnF_C2H2 463 485 1.67e-2 SMART
ZnF_C2H2 491 513 1.47e-3 SMART
ZnF_C2H2 519 541 2.4e-3 SMART
ZnF_C2H2 547 569 7.67e-2 SMART
ZnF_C2H2 575 597 8.6e-5 SMART
ZnF_C2H2 603 625 8.02e-5 SMART
ZnF_C2H2 631 653 9.22e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Other mutations in Zfp994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03065:Zfp994 APN 17 22202680 missense probably damaging 0.98
R0361:Zfp994 UTSW 17 22200110 missense probably benign 0.01
R0498:Zfp994 UTSW 17 22200901 missense probably damaging 0.99
R0567:Zfp994 UTSW 17 22200468 missense possibly damaging 0.82
R1075:Zfp994 UTSW 17 22200945 missense probably damaging 1.00
R1561:Zfp994 UTSW 17 22201225 missense probably damaging 1.00
R2117:Zfp994 UTSW 17 22200981 missense probably damaging 1.00
R2313:Zfp994 UTSW 17 22201285 missense probably damaging 1.00
R4486:Zfp994 UTSW 17 22201560 missense probably damaging 1.00
R4906:Zfp994 UTSW 17 22200467 nonsense probably null
R4924:Zfp994 UTSW 17 22200757 missense probably damaging 0.98
R5394:Zfp994 UTSW 17 22200525 missense probably damaging 1.00
R5560:Zfp994 UTSW 17 22201713 missense possibly damaging 0.62
R5746:Zfp994 UTSW 17 22201273 missense probably damaging 0.99
R6275:Zfp994 UTSW 17 22199991 nonsense probably null
R6459:Zfp994 UTSW 17 22200546 missense possibly damaging 0.83
R6668:Zfp994 UTSW 17 22201100 missense probably damaging 1.00
R7343:Zfp994 UTSW 17 22200068 missense probably benign 0.12
R7625:Zfp994 UTSW 17 22201755 missense possibly damaging 0.85
R7709:Zfp994 UTSW 17 22200425 missense probably benign 0.00
R7725:Zfp994 UTSW 17 22200110 missense probably benign 0.01
R7756:Zfp994 UTSW 17 22200847 missense possibly damaging 0.89
R7758:Zfp994 UTSW 17 22200847 missense possibly damaging 0.89
R7959:Zfp994 UTSW 17 22202780 missense probably damaging 0.99
R8033:Zfp994 UTSW 17 22200684 missense probably damaging 1.00
R8199:Zfp994 UTSW 17 22200223 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTTTGTGGGAAAAGCATTTGTC -3'
(R):5'- TACAATGGTGCAAAGCTTGATAAGG -3'

Sequencing Primer
(F):5'- GTGGGAAAAGCATTTGTCACATTCAC -3'
(R):5'- CTCATGTTGAAACAAACCAAAAGTG -3'
Posted On2020-09-02