Incidental Mutation 'R8365:Ttc27'
ID646157
Institutional Source Beutler Lab
Gene Symbol Ttc27
Ensembl Gene ENSMUSG00000024078
Gene Nametetratricopeptide repeat domain 27
Synonyms2610511O17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location74717750-74863570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74747674 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 325 (T325I)
Ref Sequence ENSEMBL: ENSMUSP00000024882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024882]
Predicted Effect probably damaging
Transcript: ENSMUST00000024882
AA Change: T325I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024882
Gene: ENSMUSG00000024078
AA Change: T325I

DomainStartEndE-ValueType
TPR 531 564 7.34e-3 SMART
TPR 565 598 5.56e-3 SMART
TPR 599 632 3.81e-1 SMART
Blast:TPR 633 666 7e-15 BLAST
coiled coil region 817 847 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Ttc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ttc27 APN 17 74780816 missense probably damaging 1.00
IGL01508:Ttc27 APN 17 74835357 missense probably damaging 0.98
IGL02010:Ttc27 APN 17 74780911 splice site probably benign
IGL02189:Ttc27 APN 17 74729899 missense probably damaging 0.99
IGL02487:Ttc27 APN 17 74856554 missense probably damaging 1.00
IGL02745:Ttc27 APN 17 74739733 missense probably benign 0.37
IGL02816:Ttc27 APN 17 74747774 splice site probably benign
IGL03389:Ttc27 APN 17 74858033 missense probably benign 0.00
R0024:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R0511:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R0518:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0521:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0633:Ttc27 UTSW 17 74729977 missense probably benign 0.02
R1415:Ttc27 UTSW 17 74739672 missense probably benign
R1597:Ttc27 UTSW 17 74863407 missense possibly damaging 0.95
R1961:Ttc27 UTSW 17 74780856 missense probably damaging 0.99
R2038:Ttc27 UTSW 17 74856502 missense probably benign 0.00
R3012:Ttc27 UTSW 17 74840459 missense probably benign 0.17
R3619:Ttc27 UTSW 17 74751128 splice site probably null
R4155:Ttc27 UTSW 17 74840460 missense probably benign 0.09
R4272:Ttc27 UTSW 17 74840360 missense probably damaging 1.00
R4291:Ttc27 UTSW 17 74856479 missense probably damaging 1.00
R4557:Ttc27 UTSW 17 74829549 missense probably benign 0.00
R5068:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5069:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5070:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5074:Ttc27 UTSW 17 74747755 missense probably damaging 1.00
R5169:Ttc27 UTSW 17 74747695 nonsense probably null
R5203:Ttc27 UTSW 17 74777654 missense probably damaging 1.00
R5272:Ttc27 UTSW 17 74742977 missense probably damaging 1.00
R6260:Ttc27 UTSW 17 74858091 missense probably damaging 0.99
R6797:Ttc27 UTSW 17 74729888 missense probably benign 0.28
R6830:Ttc27 UTSW 17 74856555 nonsense probably null
R6987:Ttc27 UTSW 17 74777741 critical splice donor site probably null
R7121:Ttc27 UTSW 17 74747715 missense probably benign 0.04
R7393:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R7543:Ttc27 UTSW 17 74717750 start gained probably benign
R7635:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R8231:Ttc27 UTSW 17 74717964 missense probably benign 0.19
X0026:Ttc27 UTSW 17 74856437 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCATGCTGACCACATTTAGGC -3'
(R):5'- GAGGTTTTGATGAAGATCTTCCC -3'

Sequencing Primer
(F):5'- TACACAGGTATGGTGCTACAGTCC -3'
(R):5'- TGAAGATCTTCCCAAACTCAGGGG -3'
Posted On2020-09-02