Incidental Mutation 'R8365:Prdm6'
ID646158
Institutional Source Beutler Lab
Gene Symbol Prdm6
Ensembl Gene ENSMUSG00000069378
Gene NamePR domain containing 6
SynonymsLOC225518, PRISM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location53464546-53575907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53552065 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 392 (V392A)
Ref Sequence ENSEMBL: ENSMUSP00000089513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091900] [ENSMUST00000115398] [ENSMUST00000115399] [ENSMUST00000154557]
Predicted Effect probably benign
Transcript: ENSMUST00000091900
AA Change: V392A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000089513
Gene: ENSMUSG00000069378
AA Change: V392A

DomainStartEndE-ValueType
low complexity region 26 73 N/A INTRINSIC
low complexity region 77 113 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
low complexity region 229 236 N/A INTRINSIC
SET 249 372 1.98e-3 SMART
ZnF_C2H2 474 494 1.24e2 SMART
ZnF_C2H2 502 524 1.58e-3 SMART
ZnF_C2H2 530 552 1.47e-3 SMART
ZnF_C2H2 558 578 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115398
SMART Domains Protein: ENSMUSP00000111056
Gene: ENSMUSG00000069378

DomainStartEndE-ValueType
ZnF_C2H2 82 102 1.24e2 SMART
ZnF_C2H2 110 132 1.58e-3 SMART
ZnF_C2H2 138 160 1.47e-3 SMART
ZnF_C2H2 166 186 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115399
AA Change: V191A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111057
Gene: ENSMUSG00000069378
AA Change: V191A

DomainStartEndE-ValueType
low complexity region 28 35 N/A INTRINSIC
SET 48 171 1.98e-3 SMART
ZnF_C2H2 273 293 1.24e2 SMART
ZnF_C2H2 301 323 1.58e-3 SMART
ZnF_C2H2 329 351 1.47e-3 SMART
ZnF_C2H2 357 377 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154557
AA Change: V231A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114644
Gene: ENSMUSG00000069378
AA Change: V231A

DomainStartEndE-ValueType
low complexity region 68 75 N/A INTRINSIC
SET 88 211 1.98e-3 SMART
ZnF_C2H2 313 333 1.24e2 SMART
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 417 1.2e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiovascular development defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Prdm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Prdm6 APN 18 53540285 missense probably benign 0.08
IGL00743:Prdm6 APN 18 53540228 missense possibly damaging 0.84
IGL02183:Prdm6 APN 18 53464677 unclassified probably benign
R1720:Prdm6 UTSW 18 53540200 missense probably benign 0.29
R1879:Prdm6 UTSW 18 53568217 missense probably damaging 1.00
R1950:Prdm6 UTSW 18 53536724 missense possibly damaging 0.90
R1962:Prdm6 UTSW 18 53568161 missense probably damaging 1.00
R2022:Prdm6 UTSW 18 53464959 unclassified probably benign
R3973:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3974:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3975:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3976:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R4012:Prdm6 UTSW 18 53540318 missense possibly damaging 0.70
R5144:Prdm6 UTSW 18 53465038 unclassified probably benign
R5640:Prdm6 UTSW 18 53536741 critical splice donor site probably null
R6113:Prdm6 UTSW 18 53473601 missense probably damaging 1.00
R6701:Prdm6 UTSW 18 53536679 missense possibly damaging 0.93
R6747:Prdm6 UTSW 18 53465046 unclassified probably benign
R6784:Prdm6 UTSW 18 53536626 missense probably benign 0.04
R7363:Prdm6 UTSW 18 53465127 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCCCTGAGCATATACTAGTTGC -3'
(R):5'- GGACCCTCTGATTCTTCACG -3'

Sequencing Primer
(F):5'- GCTTAATAAACTGCCACTAGATGAG -3'
(R):5'- CTCTGATTCTTCACGTTGATTTGG -3'
Posted On2020-09-02