Incidental Mutation 'R8365:Fbxo15'
ID646159
Institutional Source Beutler Lab
Gene Symbol Fbxo15
Ensembl Gene ENSMUSG00000034391
Gene NameF-box protein 15
SynonymsFbx15, ecat3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location84934782-84981472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 84962614 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 238 (I238S)
Ref Sequence ENSEMBL: ENSMUSP00000045925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037718] [ENSMUST00000224467] [ENSMUST00000225015] [ENSMUST00000225445]
Predicted Effect probably damaging
Transcript: ENSMUST00000037718
AA Change: I238S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045925
Gene: ENSMUSG00000034391
AA Change: I238S

DomainStartEndE-ValueType
low complexity region 35 42 N/A INTRINSIC
FBOX 46 86 3.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224467
AA Change: I193S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000225015
Predicted Effect probably damaging
Transcript: ENSMUST00000225445
AA Change: I193S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO15, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Both male and female homozygous null mice develop normally and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Fbxo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Fbxo15 APN 18 84959100 missense probably damaging 1.00
IGL01375:Fbxo15 APN 18 84958279 missense possibly damaging 0.64
IGL01730:Fbxo15 APN 18 84964174 missense probably benign 0.38
IGL01807:Fbxo15 APN 18 84981381 utr 3 prime probably benign
IGL02220:Fbxo15 APN 18 84964192 critical splice donor site probably null
IGL02255:Fbxo15 APN 18 84964196 splice site probably null
IGL02435:Fbxo15 APN 18 84959226 missense probably damaging 0.97
IGL02546:Fbxo15 APN 18 84962722 critical splice donor site probably null
IGL03099:Fbxo15 APN 18 84981213 missense possibly damaging 0.87
R0346:Fbxo15 UTSW 18 84960221 critical splice donor site probably null
R1606:Fbxo15 UTSW 18 84962620 missense possibly damaging 0.93
R1671:Fbxo15 UTSW 18 84959106 missense possibly damaging 0.73
R2113:Fbxo15 UTSW 18 84959105 missense probably benign 0.00
R3962:Fbxo15 UTSW 18 84959247 missense probably benign 0.02
R4064:Fbxo15 UTSW 18 84959118 missense probably damaging 0.96
R5523:Fbxo15 UTSW 18 84960069 missense probably damaging 1.00
R5931:Fbxo15 UTSW 18 84981125 missense probably damaging 0.96
R6235:Fbxo15 UTSW 18 84980904 intron probably benign
R6349:Fbxo15 UTSW 18 84964142 missense probably benign 0.01
R6607:Fbxo15 UTSW 18 84959145 missense possibly damaging 0.88
R7232:Fbxo15 UTSW 18 84962622 missense probably damaging 1.00
R7325:Fbxo15 UTSW 18 84959118 missense probably damaging 0.96
R7519:Fbxo15 UTSW 18 84964234 unclassified probably benign
R7671:Fbxo15 UTSW 18 84964153 missense probably damaging 1.00
R8094:Fbxo15 UTSW 18 84965493 missense probably benign 0.34
X0022:Fbxo15 UTSW 18 84960119 missense probably benign 0.00
Z1177:Fbxo15 UTSW 18 84958308 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATTTGCTCTCAGAGGAAGGG -3'
(R):5'- CAGTCTGATATGCAGGGTGC -3'

Sequencing Primer
(F):5'- CTCTCAGAGGAAGGGGAAGAAAAAC -3'
(R):5'- TGCAAGCATGGGACTGTG -3'
Posted On2020-09-02