Incidental Mutation 'R8366:Srsf12'
ID 646167
Institutional Source Beutler Lab
Gene Symbol Srsf12
Ensembl Gene ENSMUSG00000054679
Gene Name serine and arginine-rich splicing factor 12
Synonyms Sfrs13b, Srrp
MMRRC Submission 067737-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R8366 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 33208991-33233340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 33226070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 111 (P111R)
Ref Sequence ENSEMBL: ENSMUSP00000067939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067864] [ENSMUST00000108159]
AlphaFold Q8C8K3
Predicted Effect probably damaging
Transcript: ENSMUST00000067864
AA Change: P111R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067939
Gene: ENSMUSG00000054679
AA Change: P111R

DomainStartEndE-ValueType
low complexity region 31 75 N/A INTRINSIC
low complexity region 79 96 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 145 166 N/A INTRINSIC
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 204 216 9.52e-5 PROSPERO
internal_repeat_1 232 244 9.52e-5 PROSPERO
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108159
AA Change: P106R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103794
Gene: ENSMUSG00000054679
AA Change: P106R

DomainStartEndE-ValueType
RRM 11 84 9.99e-24 SMART
low complexity region 105 136 N/A INTRINSIC
low complexity region 140 161 N/A INTRINSIC
low complexity region 167 191 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik G A 11: 72,067,521 (GRCm39) Q590* probably null Het
Adnp2 T C 18: 80,173,725 (GRCm39) D228G probably damaging Het
Adrb2 T A 18: 62,311,775 (GRCm39) Y350F probably benign Het
Agbl4 T C 4: 111,423,861 (GRCm39) S296P probably damaging Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Ampd1 A T 3: 102,995,810 (GRCm39) D240V probably damaging Het
Armh3 T C 19: 45,920,793 (GRCm39) Y468C probably damaging Het
Carmil2 A G 8: 106,419,707 (GRCm39) S838G probably benign Het
Cdh23 A G 10: 60,160,799 (GRCm39) F2056L probably benign Het
Cyp4x1 A T 4: 114,970,063 (GRCm39) S381T probably benign Het
Ddx20 A G 3: 105,594,695 (GRCm39) S17P probably benign Het
Dlgap4 C A 2: 156,542,694 (GRCm39) Y32* probably null Het
Dmbt1 T C 7: 130,668,330 (GRCm39) F529L unknown Het
Ei24 A G 9: 36,697,800 (GRCm39) S117P possibly damaging Het
Esyt1 T G 10: 128,352,422 (GRCm39) N730H possibly damaging Het
Gcfc2 A G 6: 81,900,782 (GRCm39) E32G probably benign Het
Lama1 T C 17: 68,125,699 (GRCm39) I2952T Het
Mkrn3 A T 7: 62,069,543 (GRCm39) S83T probably benign Het
Ncoa2 T A 1: 13,250,830 (GRCm39) D284V probably damaging Het
Or10w1 A G 19: 13,631,903 (GRCm39) S37G probably damaging Het
Osmr T A 15: 6,850,435 (GRCm39) T724S possibly damaging Het
Pex1 A G 5: 3,676,007 (GRCm39) E825G probably benign Het
Ranbp6 A G 19: 29,789,299 (GRCm39) L351P probably damaging Het
Rbm20 C T 19: 53,838,612 (GRCm39) T863I possibly damaging Het
Rcbtb2 T C 14: 73,444,632 (GRCm39) S506P probably benign Het
Rdh12 T A 12: 79,258,288 (GRCm39) I105N probably damaging Het
Ror1 A G 4: 100,267,195 (GRCm39) I299V possibly damaging Het
Rpap3 C T 15: 97,579,548 (GRCm39) R488K probably benign Het
Rps6kb1 A C 11: 86,402,655 (GRCm39) V346G probably damaging Het
Setd2 T C 9: 110,377,816 (GRCm39) S544P probably damaging Het
Sis A T 3: 72,865,566 (GRCm39) V162E probably damaging Het
Slc16a10 A G 10: 39,952,867 (GRCm39) V209A probably benign Het
Teddm2 G T 1: 153,726,575 (GRCm39) H47N probably damaging Het
Tmem74 C T 15: 43,730,315 (GRCm39) G243R probably damaging Het
Trmt10c C T 16: 55,854,426 (GRCm39) R403Q probably benign Het
Vps11 A T 9: 44,267,052 (GRCm39) Y394* probably null Het
Zscan10 G T 17: 23,828,952 (GRCm39) R498L probably damaging Het
Other mutations in Srsf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Srsf12 APN 4 33,226,103 (GRCm39) missense possibly damaging 0.66
IGL02245:Srsf12 APN 4 33,209,103 (GRCm39) unclassified probably benign
IGL03197:Srsf12 APN 4 33,231,040 (GRCm39) missense probably damaging 1.00
IGL03412:Srsf12 APN 4 33,230,929 (GRCm39) missense probably damaging 0.99
R0173:Srsf12 UTSW 4 33,226,117 (GRCm39) missense probably damaging 1.00
R0704:Srsf12 UTSW 4 33,231,069 (GRCm39) missense probably damaging 0.99
R1618:Srsf12 UTSW 4 33,230,974 (GRCm39) missense probably damaging 0.99
R2130:Srsf12 UTSW 4 33,225,764 (GRCm39) critical splice acceptor site probably benign
R2916:Srsf12 UTSW 4 33,231,042 (GRCm39) nonsense probably null
R2989:Srsf12 UTSW 4 33,223,599 (GRCm39) missense probably damaging 1.00
R4350:Srsf12 UTSW 4 33,223,612 (GRCm39) missense possibly damaging 0.80
R4946:Srsf12 UTSW 4 33,231,174 (GRCm39) missense probably damaging 0.98
R5358:Srsf12 UTSW 4 33,209,330 (GRCm39) missense probably damaging 0.99
R5802:Srsf12 UTSW 4 33,230,929 (GRCm39) missense probably damaging 0.99
R6577:Srsf12 UTSW 4 33,209,196 (GRCm39) unclassified probably benign
R7055:Srsf12 UTSW 4 33,226,157 (GRCm39) missense probably damaging 1.00
R7392:Srsf12 UTSW 4 33,209,265 (GRCm39) missense unknown
R8365:Srsf12 UTSW 4 33,226,070 (GRCm39) missense probably damaging 0.99
R8388:Srsf12 UTSW 4 33,226,070 (GRCm39) missense probably damaging 0.99
R8389:Srsf12 UTSW 4 33,226,070 (GRCm39) missense probably damaging 0.99
R8391:Srsf12 UTSW 4 33,226,070 (GRCm39) missense probably damaging 0.99
R8696:Srsf12 UTSW 4 33,231,181 (GRCm39) missense possibly damaging 0.83
R8698:Srsf12 UTSW 4 33,231,246 (GRCm39) missense probably damaging 0.98
R8815:Srsf12 UTSW 4 33,226,045 (GRCm39) missense possibly damaging 0.83
R9653:Srsf12 UTSW 4 33,231,249 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGTAAGTGCACATGACCATTAGAG -3'
(R):5'- ATCAGCCAAGTACCTGCTCC -3'

Sequencing Primer
(F):5'- GTGCACATGACCATTAGAGCTTGC -3'
(R):5'- GCCAAGTACCTGCTCCTCCAC -3'
Posted On 2020-09-02