Incidental Mutation 'R8366:Ror1'
ID646168
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8366 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100409998 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 299 (I299V)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039630
AA Change: I299V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: I299V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik G A 11: 72,176,695 Q590* probably null Het
9130011E15Rik T C 19: 45,932,354 Y468C probably damaging Het
Adnp2 T C 18: 80,130,510 D228G probably damaging Het
Adrb2 T A 18: 62,178,704 Y350F probably benign Het
Agbl4 T C 4: 111,566,664 S296P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ampd1 A T 3: 103,088,494 D240V probably damaging Het
Carmil2 A G 8: 105,693,075 S838G probably benign Het
Cdh23 A G 10: 60,325,020 F2056L probably benign Het
Cyp4x1 A T 4: 115,112,866 S381T probably benign Het
Ddx20 A G 3: 105,687,379 S17P probably benign Het
Dlgap4 C A 2: 156,700,774 Y32* probably null Het
Dmbt1 T C 7: 131,066,600 F529L unknown Het
Ei24 A G 9: 36,786,504 S117P possibly damaging Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Gcfc2 A G 6: 81,923,801 E32G probably benign Het
Lama1 T C 17: 67,818,704 I2952T Het
Mkrn3 A T 7: 62,419,795 S83T probably benign Het
Ncoa2 T A 1: 13,180,606 D284V probably damaging Het
Olfr1490 A G 19: 13,654,539 S37G probably damaging Het
Osmr T A 15: 6,820,954 T724S possibly damaging Het
Pex1 A G 5: 3,626,007 E825G probably benign Het
Ranbp6 A G 19: 29,811,899 L351P probably damaging Het
Rbm20 C T 19: 53,850,181 T863I possibly damaging Het
Rcbtb2 T C 14: 73,207,192 S506P probably benign Het
Rdh12 T A 12: 79,211,514 I105N probably damaging Het
Rpap3 C T 15: 97,681,667 R488K probably benign Het
Rps6kb1 A C 11: 86,511,829 V346G probably damaging Het
Setd2 T C 9: 110,548,748 S544P probably damaging Het
Sis A T 3: 72,958,233 V162E probably damaging Het
Slc16a10 A G 10: 40,076,871 V209A probably benign Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Teddm2 G T 1: 153,850,829 H47N probably damaging Het
Tmem74 C T 15: 43,866,919 G243R probably damaging Het
Trmt10c C T 16: 56,034,063 R403Q probably benign Het
Vps11 A T 9: 44,355,755 Y394* probably null Het
Zscan10 G T 17: 23,609,978 R498L probably damaging Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
R7350:Ror1 UTSW 4 100425943 missense probably benign 0.00
R7492:Ror1 UTSW 4 100441059 missense probably benign 0.22
R7502:Ror1 UTSW 4 100333630 missense probably benign 0.03
R7531:Ror1 UTSW 4 100441191 missense probably damaging 1.00
R7661:Ror1 UTSW 4 100441490 missense probably damaging 1.00
R7822:Ror1 UTSW 4 100441367 missense probably damaging 1.00
R7831:Ror1 UTSW 4 100441098 missense probably benign 0.01
R8539:Ror1 UTSW 4 100441887 missense possibly damaging 0.71
R8757:Ror1 UTSW 4 100440883 missense probably benign 0.01
R8862:Ror1 UTSW 4 100334518 critical splice donor site probably null
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Z1177:Ror1 UTSW 4 100302919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATAAGTGCTCTCAGTTCGCC -3'
(R):5'- GAAGTTTCGTTGAGGCAATTCTATC -3'

Sequencing Primer
(F):5'- GTACTGTGACGAAACCTCATCTG -3'
(R):5'- GGCAATTCTATCTAATCTACCGCAG -3'
Posted On2020-09-02