Mutagenetix > Incidental Mutation

Incidental Mutation 'R8366:Carmil2'

646176

Institutional Source

Beutler Lab

Gene Symbol

Carmil2

Ensembl Gene

ENSMUSG00000050357

Gene Name

capping protein regulator and myosin 1 linker 2

Synonyms

D130029J02Rik, Rltpr

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R8366 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105686274-105698187 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105693075 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 838 (S838G)

Ref Sequence

ENSEMBL: ENSMUSP00000148422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042608] [ENSMUST00000211870] [ENSMUST00000213019]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000042608

SMART Domains

Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000

Domain	Start	End	E-Value	Type
Pfam:TPP1	11	118	2.4e-23	PFAM
low complexity region	259	272	N/A	INTRINSIC
low complexity region	296	319	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211870

Predicted Effect

probably benign
Transcript: ENSMUST00000213019
AA Change: S838G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit decreased regulatory T cells and reduced proliferative and IL2-secretion response to anti-CD3 and anti-CD28 antibodies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	G	A	11: 72,176,695	Q590*	probably null	Het
9130011E15Rik	T	C	19: 45,932,354	Y468C	probably damaging	Het
Adnp2	T	C	18: 80,130,510	D228G	probably damaging	Het
Adrb2	T	A	18: 62,178,704	Y350F	probably benign	Het
Agbl4	T	C	4: 111,566,664	S296P	probably damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Ampd1	A	T	3: 103,088,494	D240V	probably damaging	Het
Cdh23	A	G	10: 60,325,020	F2056L	probably benign	Het
Cyp4x1	A	T	4: 115,112,866	S381T	probably benign	Het
Ddx20	A	G	3: 105,687,379	S17P	probably benign	Het
Dlgap4	C	A	2: 156,700,774	Y32*	probably null	Het
Dmbt1	T	C	7: 131,066,600	F529L	unknown	Het
Ei24	A	G	9: 36,786,504	S117P	possibly damaging	Het
Esyt1	T	G	10: 128,516,553	N730H	possibly damaging	Het
Gcfc2	A	G	6: 81,923,801	E32G	probably benign	Het
Lama1	T	C	17: 67,818,704	I2952T		Het
Mkrn3	A	T	7: 62,419,795	S83T	probably benign	Het
Ncoa2	T	A	1: 13,180,606	D284V	probably damaging	Het
Olfr1490	A	G	19: 13,654,539	S37G	probably damaging	Het
Osmr	T	A	15: 6,820,954	T724S	possibly damaging	Het
Pex1	A	G	5: 3,626,007	E825G	probably benign	Het
Ranbp6	A	G	19: 29,811,899	L351P	probably damaging	Het
Rbm20	C	T	19: 53,850,181	T863I	possibly damaging	Het
Rcbtb2	T	C	14: 73,207,192	S506P	probably benign	Het
Rdh12	T	A	12: 79,211,514	I105N	probably damaging	Het
Ror1	A	G	4: 100,409,998	I299V	possibly damaging	Het
Rpap3	C	T	15: 97,681,667	R488K	probably benign	Het
Rps6kb1	A	C	11: 86,511,829	V346G	probably damaging	Het
Setd2	T	C	9: 110,548,748	S544P	probably damaging	Het
Sis	A	T	3: 72,958,233	V162E	probably damaging	Het
Slc16a10	A	G	10: 40,076,871	V209A	probably benign	Het
Srsf12	C	G	4: 33,226,070	P111R	probably damaging	Het
Teddm2	G	T	1: 153,850,829	H47N	probably damaging	Het
Tmem74	C	T	15: 43,866,919	G243R	probably damaging	Het
Trmt10c	C	T	16: 56,034,063	R403Q	probably benign	Het
Vps11	A	T	9: 44,355,755	Y394*	probably null	Het
Zscan10	G	T	17: 23,609,978	R498L	probably damaging	Het

Other mutations in Carmil2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Carmil2	APN	8	105691406	missense	probably benign	0.39
IGL01295:Carmil2	APN	8	105695516	missense	probably benign	0.44
IGL02055:Carmil2	APN	8	105696907	splice site	probably benign
IGL02532:Carmil2	APN	8	105692431	critical splice donor site	probably null
IGL02900:Carmil2	APN	8	105695519	missense	probably damaging	1.00
IGL03242:Carmil2	APN	8	105691320	splice site	probably benign
IGL03335:Carmil2	APN	8	105697029	missense	probably benign	0.14
Acubra	UTSW	8	105688498	nonsense	probably null
bowler	UTSW	8	105690805	missense	probably damaging	0.98
fedora	UTSW	8	105690766	missense	possibly damaging	0.88
fez	UTSW	8	105693045	missense	probably damaging	1.00
Panama	UTSW	8	105686315	critical splice donor site	probably null
R0544:Carmil2	UTSW	8	105691235	missense	probably damaging	1.00
R2160:Carmil2	UTSW	8	105697048	missense	possibly damaging	0.94
R2512:Carmil2	UTSW	8	105697393	missense	probably benign	0.31
R2877:Carmil2	UTSW	8	105695423	missense	probably damaging	1.00
R2943:Carmil2	UTSW	8	105692932	missense	probably benign	0.17
R4038:Carmil2	UTSW	8	105695407	missense	probably damaging	0.99
R4615:Carmil2	UTSW	8	105695074	missense	possibly damaging	0.94
R4914:Carmil2	UTSW	8	105693543	missense	possibly damaging	0.85
R5106:Carmil2	UTSW	8	105694006	splice site	probably null
R5125:Carmil2	UTSW	8	105696889	missense	probably damaging	1.00
R5178:Carmil2	UTSW	8	105696889	missense	probably damaging	1.00
R5735:Carmil2	UTSW	8	105698031	missense	probably damaging	1.00
R5991:Carmil2	UTSW	8	105691391	missense	probably null	1.00
R6035:Carmil2	UTSW	8	105692563	missense	probably benign	0.27
R6035:Carmil2	UTSW	8	105692563	missense	probably benign	0.27
R6226:Carmil2	UTSW	8	105689032	missense	possibly damaging	0.88
R6411:Carmil2	UTSW	8	105697026	missense	probably damaging	1.00
R7263:Carmil2	UTSW	8	105693045	missense	probably damaging	1.00
R7368:Carmil2	UTSW	8	105690835	missense	possibly damaging	0.46
R7409:Carmil2	UTSW	8	105692791	splice site	probably null
R7597:Carmil2	UTSW	8	105695489	missense	probably damaging	1.00
R7674:Carmil2	UTSW	8	105697286	missense	possibly damaging	0.93
R7759:Carmil2	UTSW	8	105697036	missense	possibly damaging	0.94
R7864:Carmil2	UTSW	8	105688274	missense	probably damaging	1.00
R7921:Carmil2	UTSW	8	105691104	missense	probably damaging	1.00
R8057:Carmil2	UTSW	8	105692376	missense	probably benign	0.04
R8079:Carmil2	UTSW	8	105686761	missense	probably damaging	1.00
R8343:Carmil2	UTSW	8	105691084	missense	probably benign	0.05
R8353:Carmil2	UTSW	8	105690211	missense	probably damaging	1.00
R8453:Carmil2	UTSW	8	105690211	missense	probably damaging	1.00
R8526:Carmil2	UTSW	8	105688815	missense	probably damaging	1.00
R8810:Carmil2	UTSW	8	105686315	critical splice donor site	probably null
R8925:Carmil2	UTSW	8	105688498	nonsense	probably null
R8927:Carmil2	UTSW	8	105688498	nonsense	probably null
R8944:Carmil2	UTSW	8	105690805	missense	probably damaging	0.98
R8952:Carmil2	UTSW	8	105690766	missense	possibly damaging	0.88
R9003:Carmil2	UTSW	8	105697273	missense	probably damaging	0.98
R9155:Carmil2	UTSW	8	105686290	missense	probably benign	0.12
R9318:Carmil2	UTSW	8	105687854	missense	probably benign	0.00
R9753:Carmil2	UTSW	8	105690907	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATGTTGCAGACACCTGG -3'
(R):5'- GCCTCTCCACCTGTAATACCAG -3'

Sequencing Primer
(F):5'- ACACCTGGCTGGAGGAAGC -3'
(R):5'- GGCCACCCAAAGATAGGCAG -3'

Posted On

2020-09-02