Incidental Mutation 'R8366:Rpap3'
ID646189
Institutional Source Beutler Lab
Gene Symbol Rpap3
Ensembl Gene ENSMUSG00000022466
Gene NameRNA polymerase II associated protein 3
Synonyms2310042P20Rik, D15Ertd682e
Accession Numbers

Genbank: NM_028003; MGI: 1277218

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8366 (G1)
Quality Score185.009
Status Not validated
Chromosome15
Chromosomal Location97675097-97705825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97681667 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 488 (R488K)
Ref Sequence ENSEMBL: ENSMUSP00000023104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023104]
Predicted Effect probably benign
Transcript: ENSMUST00000023104
AA Change: R488K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023104
Gene: ENSMUSG00000022466
AA Change: R488K

DomainStartEndE-ValueType
coiled coil region 9 45 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
TPR 134 167 1.12e-7 SMART
TPR 168 201 2.07e1 SMART
TPR 202 235 2.36e-6 SMART
low complexity region 252 273 N/A INTRINSIC
TPR 284 317 6.58e-5 SMART
TPR 318 351 4.45e-2 SMART
TPR 352 385 3.87e-2 SMART
Pfam:RPAP3_C 540 631 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(10) : Targeted, other(1) Gene trapped(9)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik G A 11: 72,176,695 Q590* probably null Het
9130011E15Rik T C 19: 45,932,354 Y468C probably damaging Het
Adnp2 T C 18: 80,130,510 D228G probably damaging Het
Adrb2 T A 18: 62,178,704 Y350F probably benign Het
Agbl4 T C 4: 111,566,664 S296P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ampd1 A T 3: 103,088,494 D240V probably damaging Het
Carmil2 A G 8: 105,693,075 S838G probably benign Het
Cdh23 A G 10: 60,325,020 F2056L probably benign Het
Cyp4x1 A T 4: 115,112,866 S381T probably benign Het
Ddx20 A G 3: 105,687,379 S17P probably benign Het
Dlgap4 C A 2: 156,700,774 Y32* probably null Het
Dmbt1 T C 7: 131,066,600 F529L unknown Het
Ei24 A G 9: 36,786,504 S117P possibly damaging Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Gcfc2 A G 6: 81,923,801 E32G probably benign Het
Lama1 T C 17: 67,818,704 I2952T Het
Mkrn3 A T 7: 62,419,795 S83T probably benign Het
Ncoa2 T A 1: 13,180,606 D284V probably damaging Het
Olfr1490 A G 19: 13,654,539 S37G probably damaging Het
Osmr T A 15: 6,820,954 T724S possibly damaging Het
Pex1 A G 5: 3,626,007 E825G probably benign Het
Ranbp6 A G 19: 29,811,899 L351P probably damaging Het
Rbm20 C T 19: 53,850,181 T863I possibly damaging Het
Rcbtb2 T C 14: 73,207,192 S506P probably benign Het
Rdh12 T A 12: 79,211,514 I105N probably damaging Het
Ror1 A G 4: 100,409,998 I299V possibly damaging Het
Rps6kb1 A C 11: 86,511,829 V346G probably damaging Het
Setd2 T C 9: 110,548,748 S544P probably damaging Het
Sis A T 3: 72,958,233 V162E probably damaging Het
Slc16a10 A G 10: 40,076,871 V209A probably benign Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Teddm2 G T 1: 153,850,829 H47N probably damaging Het
Tmem74 C T 15: 43,866,919 G243R probably damaging Het
Trmt10c C T 16: 56,034,063 R403Q probably benign Het
Vps11 A T 9: 44,355,755 Y394* probably null Het
Zscan10 G T 17: 23,609,978 R498L probably damaging Het
Other mutations in Rpap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Rpap3 APN 15 97703239 missense possibly damaging 0.85
IGL02714:Rpap3 APN 15 97696577 missense possibly damaging 0.93
IGL03409:Rpap3 APN 15 97681739 missense possibly damaging 0.46
R0095:Rpap3 UTSW 15 97680536 splice site probably benign
R0847:Rpap3 UTSW 15 97703201 critical splice donor site probably null
R1496:Rpap3 UTSW 15 97686483 missense possibly damaging 0.86
R1562:Rpap3 UTSW 15 97694217 missense possibly damaging 0.86
R1603:Rpap3 UTSW 15 97701121 missense possibly damaging 0.53
R1801:Rpap3 UTSW 15 97694209 missense possibly damaging 0.73
R2163:Rpap3 UTSW 15 97680348 missense possibly damaging 0.71
R4969:Rpap3 UTSW 15 97686526 missense probably benign
R5226:Rpap3 UTSW 15 97703223 missense possibly damaging 0.53
R6610:Rpap3 UTSW 15 97688168 missense probably benign 0.24
R6613:Rpap3 UTSW 15 97681841 critical splice acceptor site probably null
R7040:Rpap3 UTSW 15 97679112 missense possibly damaging 0.51
R7429:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7430:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7829:Rpap3 UTSW 15 97681708 missense probably benign 0.02
R7853:Rpap3 UTSW 15 97678418 missense possibly damaging 0.92
R8223:Rpap3 UTSW 15 97691304 missense probably benign 0.02
YA93:Rpap3 UTSW 15 97693233 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAAGCTCGCTAGACCGTTCG -3'
(R):5'- TGTTAGCTGGAAGAACATAGCAGTC -3'

Sequencing Primer
(F):5'- CGCTAGACCGTTCGTTAGTTAGC -3'
(R):5'- TTTGTGACCTTAAGATGGGAAAAC -3'
Posted On2020-09-02