Incidental Mutation 'R8366:Adnp2'
ID646194
Institutional Source Beutler Lab
Gene Symbol Adnp2
Ensembl Gene ENSMUSG00000053950
Gene NameADNP homeobox 2
SynonymsZfp508, 8430420L05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8366 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location80126311-80151482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80130510 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 228 (D228G)
Ref Sequence ENSEMBL: ENSMUSP00000068560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066743]
Predicted Effect probably damaging
Transcript: ENSMUST00000066743
AA Change: D228G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068560
Gene: ENSMUSG00000053950
AA Change: D228G

DomainStartEndE-ValueType
ZnF_C2H2 73 96 4.57e0 SMART
ZnF_C2H2 106 128 1.06e2 SMART
ZnF_C2H2 155 178 5.48e0 SMART
ZnF_C2H2 215 240 7.29e0 SMART
low complexity region 277 290 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 333 355 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 625 648 N/A INTRINSIC
low complexity region 656 674 N/A INTRINSIC
ZnF_C2H2 696 718 9.96e0 SMART
ZnF_C2H2 724 746 4.99e1 SMART
low complexity region 747 761 N/A INTRINSIC
ZnF_C2H2 777 798 1.93e2 SMART
ZnF_C2H2 800 823 4.34e0 SMART
ZnF_C2H2 905 928 5.81e-2 SMART
HOX 1073 1135 3.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik G A 11: 72,176,695 Q590* probably null Het
9130011E15Rik T C 19: 45,932,354 Y468C probably damaging Het
Adrb2 T A 18: 62,178,704 Y350F probably benign Het
Agbl4 T C 4: 111,566,664 S296P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ampd1 A T 3: 103,088,494 D240V probably damaging Het
Carmil2 A G 8: 105,693,075 S838G probably benign Het
Cdh23 A G 10: 60,325,020 F2056L probably benign Het
Cyp4x1 A T 4: 115,112,866 S381T probably benign Het
Ddx20 A G 3: 105,687,379 S17P probably benign Het
Dlgap4 C A 2: 156,700,774 Y32* probably null Het
Dmbt1 T C 7: 131,066,600 F529L unknown Het
Ei24 A G 9: 36,786,504 S117P possibly damaging Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Gcfc2 A G 6: 81,923,801 E32G probably benign Het
Lama1 T C 17: 67,818,704 I2952T Het
Mkrn3 A T 7: 62,419,795 S83T probably benign Het
Ncoa2 T A 1: 13,180,606 D284V probably damaging Het
Olfr1490 A G 19: 13,654,539 S37G probably damaging Het
Osmr T A 15: 6,820,954 T724S possibly damaging Het
Pex1 A G 5: 3,626,007 E825G probably benign Het
Ranbp6 A G 19: 29,811,899 L351P probably damaging Het
Rbm20 C T 19: 53,850,181 T863I possibly damaging Het
Rcbtb2 T C 14: 73,207,192 S506P probably benign Het
Rdh12 T A 12: 79,211,514 I105N probably damaging Het
Ror1 A G 4: 100,409,998 I299V possibly damaging Het
Rpap3 C T 15: 97,681,667 R488K probably benign Het
Rps6kb1 A C 11: 86,511,829 V346G probably damaging Het
Setd2 T C 9: 110,548,748 S544P probably damaging Het
Sis A T 3: 72,958,233 V162E probably damaging Het
Slc16a10 A G 10: 40,076,871 V209A probably benign Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Teddm2 G T 1: 153,850,829 H47N probably damaging Het
Tmem74 C T 15: 43,866,919 G243R probably damaging Het
Trmt10c C T 16: 56,034,063 R403Q probably benign Het
Vps11 A T 9: 44,355,755 Y394* probably null Het
Zscan10 G T 17: 23,609,978 R498L probably damaging Het
Other mutations in Adnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Adnp2 APN 18 80128867 missense probably benign 0.00
IGL00730:Adnp2 APN 18 80128032 missense probably benign
IGL01615:Adnp2 APN 18 80128477 missense probably damaging 1.00
IGL01681:Adnp2 APN 18 80127888 missense probably damaging 1.00
IGL02549:Adnp2 APN 18 80129118 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0325:Adnp2 UTSW 18 80130653 missense probably benign 0.06
R0478:Adnp2 UTSW 18 80129334 missense probably benign 0.31
R0545:Adnp2 UTSW 18 80129401 missense probably benign 0.31
R0788:Adnp2 UTSW 18 80130004 missense probably benign
R1756:Adnp2 UTSW 18 80127697 makesense probably null
R2043:Adnp2 UTSW 18 80128326 missense probably damaging 1.00
R2121:Adnp2 UTSW 18 80129170 missense probably benign 0.00
R2260:Adnp2 UTSW 18 80128449 missense probably benign 0.01
R2374:Adnp2 UTSW 18 80130987 missense probably damaging 1.00
R3416:Adnp2 UTSW 18 80128158 missense possibly damaging 0.55
R3607:Adnp2 UTSW 18 80129069 missense probably damaging 1.00
R4012:Adnp2 UTSW 18 80130821 missense probably benign 0.01
R4260:Adnp2 UTSW 18 80137527 missense possibly damaging 0.85
R4588:Adnp2 UTSW 18 80128648 missense probably benign 0.22
R5158:Adnp2 UTSW 18 80137543 missense probably damaging 0.99
R5652:Adnp2 UTSW 18 80130850 missense probably damaging 1.00
R5717:Adnp2 UTSW 18 80128264 missense probably benign 0.13
R6743:Adnp2 UTSW 18 80128059 missense probably benign 0.00
R6786:Adnp2 UTSW 18 80129745 missense probably benign 0.03
R6903:Adnp2 UTSW 18 80130090 missense probably benign
R7105:Adnp2 UTSW 18 80128151 missense possibly damaging 0.94
R7507:Adnp2 UTSW 18 80130853 missense probably benign 0.22
R7620:Adnp2 UTSW 18 80130487 missense probably damaging 1.00
R7914:Adnp2 UTSW 18 80130841 missense probably damaging 0.96
R7991:Adnp2 UTSW 18 80129322 missense probably damaging 0.97
R8290:Adnp2 UTSW 18 80142733 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACTGTTCTGTGGCAAAGC -3'
(R):5'- CAGCATGAAGAAGCACGTGC -3'

Sequencing Primer
(F):5'- TTCTGTGGCAAAGCAAGCTG -3'
(R):5'- GTGCTGGTGGCCCATTTCAATTAC -3'
Posted On2020-09-02