Incidental Mutation 'R8366:Olfr1490'
ID646195
Institutional Source Beutler Lab
Gene Symbol Olfr1490
Ensembl Gene ENSMUSG00000061387
Gene Nameolfactory receptor 1490
SynonymsMOR266-6P, GA_x6K02T2RE5P-3987000-3987950
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8366 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13651091-13659545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13654539 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 37 (S37G)
Ref Sequence ENSEMBL: ENSMUSP00000151186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080162] [ENSMUST00000213900]
Predicted Effect probably damaging
Transcript: ENSMUST00000080162
AA Change: S32G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079057
Gene: ENSMUSG00000061387
AA Change: S32G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-48 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213900
AA Change: S37G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik G A 11: 72,176,695 Q590* probably null Het
9130011E15Rik T C 19: 45,932,354 Y468C probably damaging Het
Adnp2 T C 18: 80,130,510 D228G probably damaging Het
Adrb2 T A 18: 62,178,704 Y350F probably benign Het
Agbl4 T C 4: 111,566,664 S296P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ampd1 A T 3: 103,088,494 D240V probably damaging Het
Carmil2 A G 8: 105,693,075 S838G probably benign Het
Cdh23 A G 10: 60,325,020 F2056L probably benign Het
Cyp4x1 A T 4: 115,112,866 S381T probably benign Het
Ddx20 A G 3: 105,687,379 S17P probably benign Het
Dlgap4 C A 2: 156,700,774 Y32* probably null Het
Dmbt1 T C 7: 131,066,600 F529L unknown Het
Ei24 A G 9: 36,786,504 S117P possibly damaging Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Gcfc2 A G 6: 81,923,801 E32G probably benign Het
Lama1 T C 17: 67,818,704 I2952T Het
Mkrn3 A T 7: 62,419,795 S83T probably benign Het
Ncoa2 T A 1: 13,180,606 D284V probably damaging Het
Osmr T A 15: 6,820,954 T724S possibly damaging Het
Pex1 A G 5: 3,626,007 E825G probably benign Het
Ranbp6 A G 19: 29,811,899 L351P probably damaging Het
Rbm20 C T 19: 53,850,181 T863I possibly damaging Het
Rcbtb2 T C 14: 73,207,192 S506P probably benign Het
Rdh12 T A 12: 79,211,514 I105N probably damaging Het
Ror1 A G 4: 100,409,998 I299V possibly damaging Het
Rpap3 C T 15: 97,681,667 R488K probably benign Het
Rps6kb1 A C 11: 86,511,829 V346G probably damaging Het
Setd2 T C 9: 110,548,748 S544P probably damaging Het
Sis A T 3: 72,958,233 V162E probably damaging Het
Slc16a10 A G 10: 40,076,871 V209A probably benign Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Teddm2 G T 1: 153,850,829 H47N probably damaging Het
Tmem74 C T 15: 43,866,919 G243R probably damaging Het
Trmt10c C T 16: 56,034,063 R403Q probably benign Het
Vps11 A T 9: 44,355,755 Y394* probably null Het
Zscan10 G T 17: 23,609,978 R498L probably damaging Het
Other mutations in Olfr1490
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr1490 APN 19 13654933 missense probably damaging 0.96
IGL01335:Olfr1490 APN 19 13655176 missense probably damaging 1.00
IGL01561:Olfr1490 APN 19 13654905 missense probably benign
IGL01644:Olfr1490 APN 19 13655404 utr 3 prime probably benign
IGL02257:Olfr1490 APN 19 13655265 missense probably benign
IGL02282:Olfr1490 APN 19 13655258 missense probably damaging 1.00
IGL02355:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02362:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02639:Olfr1490 APN 19 13654596 missense possibly damaging 0.73
R0078:Olfr1490 UTSW 19 13654815 missense probably benign 0.00
R0278:Olfr1490 UTSW 19 13654764 missense probably damaging 1.00
R0278:Olfr1490 UTSW 19 13654765 missense probably damaging 1.00
R0506:Olfr1490 UTSW 19 13654897 missense possibly damaging 0.62
R0927:Olfr1490 UTSW 19 13654452 missense probably damaging 0.99
R1087:Olfr1490 UTSW 19 13655012 nonsense probably null
R1762:Olfr1490 UTSW 19 13654504 missense probably benign
R2901:Olfr1490 UTSW 19 13654945 missense probably damaging 1.00
R2907:Olfr1490 UTSW 19 13655247 missense possibly damaging 0.84
R3625:Olfr1490 UTSW 19 13654982 nonsense probably null
R3838:Olfr1490 UTSW 19 13654957 missense probably benign 0.00
R4745:Olfr1490 UTSW 19 13655386 missense probably benign
R4804:Olfr1490 UTSW 19 13654518 missense probably benign
R5026:Olfr1490 UTSW 19 13654932 missense probably benign 0.03
R5314:Olfr1490 UTSW 19 13655266 missense probably benign 0.08
R6052:Olfr1490 UTSW 19 13654507 missense possibly damaging 0.95
R6235:Olfr1490 UTSW 19 13654781 nonsense probably null
R7405:Olfr1490 UTSW 19 13654882 missense probably benign 0.14
R7557:Olfr1490 UTSW 19 13655026 missense possibly damaging 0.71
R8038:Olfr1490 UTSW 19 13655355 missense possibly damaging 0.91
R8338:Olfr1490 UTSW 19 13654852 missense possibly damaging 0.92
Z1176:Olfr1490 UTSW 19 13654463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCACTGCCAAACTATTTGCAG -3'
(R):5'- CTCAGACTGAAAGTTGTTGGC -3'

Sequencing Primer
(F):5'- GTCCAGTACAGGGGAACACC -3'
(R):5'- TTGGCCAAAATGTGTGGTACCAC -3'
Posted On2020-09-02